Sample records for p53-specific t-cell responses

  1. Split T Cell Tolerance against a Self/Tumor Antigen: Spontaneous CD4+ but Not CD8+ T Cell Responses against p53 in Cancer Patients and Healthy Donors

    PubMed Central

    Tsuji, Takemasa; Matsuzaki, Junko; Ritter, Erika; Miliotto, Anthony; Ritter, Gerd; Odunsi, Kunle; Old, Lloyd J.; Gnjatic, Sacha

    2011-01-01

    Analyses of NY-ESO-1-specific spontaneous immune responses in cancer patients revealed that antibody and both CD4+ and CD8+ T cell responses were induced together in cancer patients. To explore whether such integrated immune responses are also spontaneously induced for other tumor antigens, we have evaluated antibody and T cell responses against self/tumor antigen p53 in ovarian cancer patients and healthy individuals. We found that 21% (64/298) of ovarian cancer patients but no healthy donors showed specific IgG responses against wild-type p53 protein. While none of 12 patients with high titer p53 antibody showed spontaneous p53-specific CD8+ T cell responses following a single in vitro sensitization, significant p53-specific IFN-γ producing CD4+ T cells were detected in 6 patients. Surprisingly, similar levels of p53-specific CD4+ T cells but not CD8+ T cells were also detected in 5/10 seronegative cancer patients and 9/12 healthy donors. Importantly, p53-specific CD4+ T cells in healthy donors originated from a CD45RA− antigen-experienced T cell population and recognized naturally processed wild-type p53 protein. These results raise the possibility that p53-specific CD4+ T cells reflect abnormalities in p53 occurring in normal individuals and that they may play a role in processes of immunosurveillance or immunoregulation of p53-related neoplastic events. PMID:21858191

  2. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  3. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    PubMed

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  4. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

    PubMed

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

    2016-01-05

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

  5. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    PubMed Central

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

    2016-01-01

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

  6. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

    PubMed Central

    1994-01-01

    Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have

  7. Transcriptional specificity in various p53-mutant cells.

    PubMed

    Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

    2013-03-01

    Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

  8. Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.

    PubMed

    O'Neill, F J; Hu, Y; Chen, T; Carney, H

    1997-02-27

    In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.

  9. p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

    PubMed Central

    Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

    2016-01-01

    SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

  10. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  11. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

    PubMed Central

    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

    2014-01-01

    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  12. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    PubMed

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  13. Inhibition of NAMPT pathway by FK866 activates the function of p53 in HEK293T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thakur, Basant Kumar, E-mail: thakur.basant@mh-hannover.de; Department of Molecular Hematopoiesis, Hannover Medical School, Carl Neuberg Str-1, 30625 Hannover; Dittrich, Tino

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer In 293T cells, p53 is considered to be inactive due to its interaction with the large T-antigen. Black-Right-Pointing-Pointer Acetylation of p53 at lysine 382 is important for its functional activation. Black-Right-Pointing-Pointer First evidence to document the presence of a functional p53 in 293T cells. Black-Right-Pointing-Pointer Inhibition of NAMPT/SIRT pathway by FK866 in 293T cells increases the functional activity of p53. Black-Right-Pointing-Pointer This activation of p53 involves reversible acetylation of p53 at lysine 382. -- Abstract: Inactivation of p53 protein by endogenous and exogenous carcinogens is involved in the pathogenesis of different human malignancies. In cancer associated with SV-40more » DNA tumor virus, p53 is considered to be non-functional mainly due to its interaction with the large T-antigen. Using the 293T cell line (HEK293 cells transformed with large T antigen) as a model, we provide evidence that p53 is one of the critical downstream targets involved in FK866-mediated killing of 293T cells. A reduced rate of apoptosis and an increased number of cells in S-phase was accompanied after knockdown of p53 in these cells. Inhibition of NAMPT by FK866, or inhibition of SIRT by nicotinamide decreased proliferation and triggered death of 293T cells involving the p53 acetylation pathway. Additionally, knockdown of p53 attenuated the effect of FK866 on cell proliferation, apoptosis, and cell cycle arrest. The data presented here shed light on two important facts: (1) that p53 in 293T cells is active in the presence of FK866, an inhibitor of NAMPT pathway; (2) the apoptosis induced by FK866 in 293T cells is associated with increased acetylation of p53 at Lys382, which is required for the functional activity of p53.« less

  14. Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

    PubMed Central

    Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

    2013-01-01

    Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

  15. Virus-specific T cell responses in macaques acutely infected with SHIVsf162p3

    PubMed Central

    Pahar, Bapi; Wang, Xiaolei; Dufour, Jason; Lackner, Andrew A.; Veazey, Ronald S.

    2007-01-01

    CD4+ T helper and CD8+ cytotoxic T lymphocyte responses are believed to play an important role in the control of primary HIV and SIV infection. However, the role of these cells in macaques acutely infected with SHIVsf162p3 has not been well characterized. In this study, ten adult rhesus macaques were intravaginally infected with SHIVsf162p3, and antigen specific cytokine responses to SHIV-Tat, Nef, Gag and Env peptide pools were examined through 70 days post inoculation (p.i.) using ELISPOT and/or cytokine flow cytometry (CFC). Peak plasma viral replication occurred between 14 and 21 days p.i., followed by low to undetectable plasma viremia by 70 days of infection in most macaques. Although some animals had strong virus-specific cellular immune responses, many had weak or minimal responses that did not correlate with the post peak decline in plasma viremia. PMID:17307212

  16. Phase I dendritic cell p53 peptide vaccine for head and neck cancer.

    PubMed

    Schuler, Patrick J; Harasymczuk, Malgorzata; Visus, Carmen; Deleo, Albert; Trivedi, Sumita; Lei, Yu; Argiris, Athanassios; Gooding, William; Butterfield, Lisa H; Whiteside, Theresa L; Ferris, Robert L

    2014-05-01

    p53 accumulation in head and neck squamous cell carcinoma (HNSCC) cells creates a targetable tumor antigen. Adjuvant dendritic cell (DC)-based vaccination against p53 was tested in a phase I clinical trial. Monocyte-derived DC from 16 patients were loaded with two modified HLA-class I p53 peptides (Arm 1), additional Th tetanus toxoid peptide (Arm 2), or additional Th wild-type (wt) p53-specific peptide (Arm 3). Vaccine DCs (vDC) were delivered to inguinal lymph nodes at three time points. vDC phenotype, circulating p53-specific T cells, and regulatory T cells (Treg) were serially monitored by flow cytometry and cytokine production by Luminex. vDC properties were compared with those of DC1 generated with an alternative maturation regimen. No grade II-IV adverse events were observed. Two-year disease-free survival of 88% was favorable. p53-specific T-cell frequencies were increased postvaccination in 11 of 16 patients (69%), with IFN-γ secretion detected in four of 16 patients. Treg frequencies were consistently decreased (P = 0.006) relative to prevaccination values. The phenotype and function of DC1 were improved relative to vDC. Adjuvant p53-specific vaccination of patients with HNSCC was safe and associated with promising clinical outcome, decreased Treg levels, and modest vaccine-specific immunity. HNSCC patients' DC required stronger maturation stimuli to reverse immune suppression and improve vaccine efficacy. ©2014 AACR.

  17. The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

  18. Virus-specific T cell responses in macaques acutely infected with SHIV(sf162p3).

    PubMed

    Pahar, Bapi; Wang, Xiaolei; Dufour, Jason; Lackner, Andrew A; Veazey, Ronald S

    2007-06-20

    CD4(+) T helper and CD8(+) cytotoxic T lymphocyte responses are believed to play an important role in the control of primary HIV and SIV infection. However, the role of these cells in macaques acutely infected with SHIV(sf162p3) has not been well characterized. In this study, ten adult rhesus macaques were intravaginally infected with SHIV(sf162p3), and antigen-specific cytokine responses to SHIV-Tat, Nef, Gag and Env peptide pools were examined through 70 days post inoculation (p.i.) using ELISPOT and/or cytokine flow cytometry (CFC). Peak plasma viral replication occurred between 14 and 21 days p.i. followed by low to undetectable plasma viremia by 70 days of infection in most macaques. Although some animals had strong virus-specific cellular immune responses, many had weak or minimal responses that did not correlate with the post peak decline in plasma viremia.

  19. Derivation of Thymic Lymphoma T-cell Lines from Atm-/- and p53-/- Mice

    PubMed Central

    Jinadasa, Rasika; Balmus, Gabriel; Gerwitz, Lee; Roden, Jamie; Weiss, Robert; Duhamel, Gerald

    2011-01-01

    Established cell lines are a critical research tool that can reduce the use of laboratory animals in research. Certain strains of genetically modified mice, such as Atm-/- and p53-/- consistently develop thymic lymphoma early in life 1,2, and thus, can serve as a reliable source for derivation of murine T-cell lines. Here we present a detailed protocol for the development of established murine thymic lymphoma T-cell lines without the need to add interleukins as described in previous protocols 1,3. Tumors were harvested from mice aged three to six months, at the earliest indication of visible tumors based on the observation of hunched posture, labored breathing, poor grooming and wasting in a susceptible strain 1,4. We have successfully established several T-cell lines using this protocol and inbred strains ofAtm-/- [FVB/N-Atmtm1Led/J] 2 and p53-/- [129/S6-Trp53tm1Tyj/J] 5 mice. We further demonstrate that more than 90% of the established T-cell population expresses CD3, CD4 and CD8. Consistent with stably established cell lines, the T-cells generated by using the present protocol have been passaged for over a year. PMID:21490582

  20. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    PubMed Central

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  1. p53 Hypersensitivity Is the Predominant Mechanism of the Unique Responsiveness of Testicular Germ Cell Tumor (TGCT) Cells to Cisplatin

    PubMed Central

    Gutekunst, Matthias; Oren, Moshe; Weilbacher, Andrea; Dengler, Michael A.; Markwardt, Christiane; Thomale, Jürgen; Aulitzky, Walter E.; van der Kuip, Heiko

    2011-01-01

    Consistent with the excellent clinical results in testicular germ cell tumors (TGCT), most cell lines derived from this cancer show an exquisite sensitivity to Cisplatin. It is well accepted that the high susceptibility of TGCT cells to apoptosis plays a central role in this hypersensitive phenotype. The role of the tumor suppressor p53 in this response, however, remains controversial. Here we show that siRNA-mediated silencing of p53 is sufficient to completely abrogate hypersensitivity not only to Cisplatin but also to non-genotoxic inducers of p53 such as the Mdm2 antagonist Nutlin-3 and the proteasome inhibitor Bortezomib. The close relationship between p53 protein levels and induction of apoptosis is lost upon short-term differentiation, indicating that this predominant pro-apoptotic function of p53 is unique in pluripotent embryonal carcinoma (EC) cells. RNA interference experiments as well as microarray analysis demonstrated a central role of the pro-apoptotic p53 target gene NOXA in the p53-dependent apoptotic response of these cells. In conclusion, our data indicate that the hypersensitivity of TGCT cells is a result of their unique sensitivity to p53 activation. Furthermore, in the very specific cellular context of germ cell-derived pluripotent EC cells, p53 function appears to be limited to induction of apoptosis. PMID:21532991

  2. Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

    PubMed Central

    Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

    2000-01-01

    p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

  3. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  4. New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

    PubMed Central

    Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

    1999-01-01

    Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

  5. Dectin-1 diversifies Aspergillus fumigatus–specific T cell responses by inhibiting T helper type 1 CD4 T cell differentiation

    PubMed Central

    Hohl, Tobias M.; Collins, Nichole; Leiner, Ingrid; Gallegos, Alena; Saijo, Shinobu; Coward, Jesse W.; Iwakura, Yoichiro

    2011-01-01

    Pulmonary infection of mice with Aspergillus fumigatus induces concurrent T helper type 1 (Th1) and Th17 responses that depend on Toll-like receptor/MyD88 and Dectin-1, respectively. However, the mechanisms balancing Th1 and Th17 CD4 T cell populations during infection remain incompletely defined. In this study, we show that Dectin-1 deficiency disproportionally increases Th1 responses and decreases Th17 differentiation after A. fumigatus infection. Dectin-1 signaling in A. fumigatus–infected wild-type mice reduces IFN-γ and IL-12p40 expression in the lung, thereby decreasing T-bet expression in responding CD4 T cells and enhancing Th17 responses. Absence of IFN-γ or IL-12p35 in infected mice or T-bet in responding CD4 T cells enhances Th17 differentiation, independent of Dectin-1 expression, in A. fumigatus–infected mice. Transient deletion of monocyte-derived dendritic cells also reduces Th1 and boosts Th17 differentiation of A. fumigatus–specific CD4 T cells. Our findings indicate that Dectin-1–mediated signals alter CD4 T cell responses to fungal infection by decreasing the production of IL-12 and IFN-γ in innate cells, thereby decreasing T-bet expression in A. fumigatus–specific CD4 T cells and enabling Th17 differentiation. PMID:21242294

  6. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    PubMed Central

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  7. Selective resistance of CD44hi T cells to p53-dependent cell death results in persistence of immunologic memory after total body irradiation.

    PubMed

    Yao, Zhenyu; Jones, Jennifer; Kohrt, Holbrook; Strober, Samuel

    2011-10-15

    Our previous studies showed that treatment of mice with total body irradiation (TBI) or total lymphoid tissue irradiation markedly changes the balance of residual T cell subsets to favor CD4(+)CD44(hi) NKT cells because of the differential resistance of the latter subset to cell death. The object of the current study was to further elucidate the changed balance and mechanisms of differential radioresistance of T cell subsets after graded doses of TBI. The experimental results showed that CD4(+) T cells were markedly more resistant than CD8(+) T cells, and CD44(hi) T cells, including NKT cells and memory T cells, were markedly more resistant than CD44(lo) (naive) T cells. The memory T cells immunized to alloantigens persisted even after myeloablative (1000 cGy) TBI and were able to prevent engraftment of bone marrow transplants. Although T cell death after 1000 cGy was prevented in p53(-/-) mice, there was progressive T cell death in p53(-/-) mice at higher doses. Although p53-dependent T cell death changed the balance of subsets, p53-independent T cell death did not. In conclusion, resistance of CD44(hi) T cells to p53-dependent cell death results in the persistence of immunological memory after TBI and can explain the immune-mediated rejection of marrow transplants in sensitized recipients.

  8. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    PubMed Central

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  9. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    PubMed Central

    Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

    2015-01-01

    Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

  10. p53 shapes genome-wide and cell type-specific changes in microRNA expression during the human DNA damage response.

    PubMed

    Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R

    2014-01-01

    The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.

  11. Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation

    NASA Astrophysics Data System (ADS)

    Armitage, Mark

    Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

  12. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  13. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    PubMed Central

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-01-01

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

  14. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    PubMed

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  15. A p53-dependent response limits the viability of mammalian haploid cells

    PubMed Central

    Olbrich, Teresa; Mayor-Ruiz, Cristina; Vega-Sendino, Maria; Gomez, Carmen; Ortega, Sagrario; Ruiz, Sergio; Fernandez-Capetillo, Oscar

    2017-01-01

    The recent development of haploid cell lines has facilitated forward genetic screenings in mammalian cells. These lines include near-haploid human cell lines isolated from a patient with chronic myelogenous leukemia (KBM7 and HAP1), as well as haploid embryonic stem cells derived from several organisms. In all cases, haploidy was shown to be an unstable state, so that cultures of mammalian haploid cells rapidly become enriched in diploids. Here we show that the observed diploidization is due to a proliferative disadvantage of haploid cells compared with diploid cells. Accordingly, single-cell–sorted haploid mammalian cells maintain the haploid state for prolonged periods, owing to the absence of competing diploids. Although the duration of interphase is similar in haploid and diploid cells, haploid cells spend longer in mitosis, indicative of problems in chromosome segregation. In agreement with this, a substantial proportion of the haploids die at or shortly after the last mitosis through activation of a p53-dependent cytotoxic response. Finally, we show that p53 deletion stabilizes haploidy in human HAP1 cells and haploid mouse embryonic stem cells. We propose that, similar to aneuploidy or tetraploidy, haploidy triggers a p53-dependent response that limits the fitness of mammalian cells. PMID:28808015

  16. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGES

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  17. Plasmacytoid Dendritic Cells Require Direct Infection To Sustain the Pulmonary Influenza A Virus-Specific CD8 T Cell Response

    PubMed Central

    Hemann, Emily A.; Sjaastad, Louisa E.; Langlois, Ryan A.

    2015-01-01

    ABSTRACT Following influenza A virus (IAV) infection, development of a robust IAV-specific CD8 T cell response is required for clearance of primary infection and enhances memory protection. Following IAV infection, plasmacytoid dendritic cells (pDC) or CD8α+ DC regulate pulmonary effector CD8 T cell responses within the lung. Without this DC-T cell interaction, insufficient effector CD8 T cells are maintained in the lungs, leading to enhanced morbidity and mortality. Previous studies have demonstrated that pDC are capable of classical presentation or cross-presentation of IAV antigens and could potentially regulate IAV-specific CD8 T cell responses through either mechanism. Our results demonstrate that pDC from the lungs of donor mice infected with an IAV that is not able to replicate in hematopoietic cells (142t-IAV), unlike donor pDC isolated from the lungs of control infected mice, are not able to rescue the host IAV-specific CD8 T cell response from apoptosis. This indicates that pDC must utilize the direct presentation pathway for this rescue. This inability of pDC from 142t-IAV donors to rescue the IAV-specific CD8 T cell response is not due to differences in the overall ability of 142t-IAV to replicate within the lungs or generate defective viral genomes or to differences in levels of costimulatory molecules required for this interaction. We further demonstrate that bypassing the antigen presentation pathway by coating the 142t-IAV pDC with IAV peptide epitopes restores their ability to rescue the IAV-specific CD8 T cell response. IMPORTANCE IAV continues to be a global health burden, infecting 5 to 20% of the global population annually. Continued investigation into the mechanisms that mediate protective immune responses against IAV is important to improving current vaccination and antiviral strategies antagonistic toward IAV. Our findings presented herein demonstrate a key requirement for pDC promotion of effector CD8 T cell survival: that rather than

  18. Plasmacytoid Dendritic Cells Require Direct Infection To Sustain the Pulmonary Influenza A Virus-Specific CD8 T Cell Response.

    PubMed

    Hemann, Emily A; Sjaastad, Louisa E; Langlois, Ryan A; Legge, Kevin L

    2015-12-30

    Following influenza A virus (IAV) infection, development of a robust IAV-specific CD8 T cell response is required for clearance of primary infection and enhances memory protection. Following IAV infection, plasmacytoid dendritic cells (pDC) or CD8α(+) DC regulate pulmonary effector CD8 T cell responses within the lung. Without this DC-T cell interaction, insufficient effector CD8 T cells are maintained in the lungs, leading to enhanced morbidity and mortality. Previous studies have demonstrated that pDC are capable of classical presentation or cross-presentation of IAV antigens and could potentially regulate IAV-specific CD8 T cell responses through either mechanism. Our results demonstrate that pDC from the lungs of donor mice infected with an IAV that is not able to replicate in hematopoietic cells (142t-IAV), unlike donor pDC isolated from the lungs of control infected mice, are not able to rescue the host IAV-specific CD8 T cell response from apoptosis. This indicates that pDC must utilize the direct presentation pathway for this rescue. This inability of pDC from 142t-IAV donors to rescue the IAV-specific CD8 T cell response is not due to differences in the overall ability of 142t-IAV to replicate within the lungs or generate defective viral genomes or to differences in levels of costimulatory molecules required for this interaction. We further demonstrate that bypassing the antigen presentation pathway by coating the 142t-IAV pDC with IAV peptide epitopes restores their ability to rescue the IAV-specific CD8 T cell response. IAV continues to be a global health burden, infecting 5 to 20% of the global population annually. Continued investigation into the mechanisms that mediate protective immune responses against IAV is important to improving current vaccination and antiviral strategies antagonistic toward IAV. Our findings presented herein demonstrate a key requirement for pDC promotion of effector CD8 T cell survival: that rather than utilizing cross

  19. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    PubMed

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  20. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    PubMed

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a

  1. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

    PubMed Central

    2014-01-01

    Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be

  2. [Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

    PubMed

    Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

    2017-01-01

    PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I

  3. p53 predictive value for pT1-2 N0 disease at radical cystectomy.

    PubMed

    Shariat, Shahrokh F; Lotan, Yair; Karakiewicz, Pierre I; Ashfaq, Raheela; Isbarn, Hendrik; Fradet, Yves; Bastian, Patrick J; Nielsen, Matthew E; Capitanio, Umberto; Jeldres, Claudio; Montorsi, Francesco; Müller, Stefan C; Karam, Jose A; Heukamp, Lukas C; Netto, George; Lerner, Seth P; Sagalowsky, Arthur I; Cote, Richard J

    2009-09-01

    Approximately 15% to 30% of patients with pT1-2N0M0 urothelial carcinoma of the bladder experience disease progression despite radical cystectomy with curative intent. We determined whether p53 expression would improve the prediction of disease progression after radical cystectomy for pT1-2N0M0 UCB. In a multi-institutional retrospective cohort we identified 324 patients with pT1-2N0M0 urothelial carcinoma of the bladder who underwent radical cystectomy. Analysis focused on a testing cohort of 272 patients and an external validation of 52. Competing risks regression models were used to test the association of variables with cancer specific mortality after accounting for nonbladder cancer caused mortality. In the testing cohort 91 patients (33.5%) had altered p53 expression (p53alt). On multivariate competing risks regression analysis altered p53 achieved independent status for predicting disease recurrence and cancer specific mortality (each p <0.001). Adding p53 increased the accuracy of multivariate competing risks regression models predicting recurrence and cancer specific mortality by 5.7% (62.0% vs 67.7%) and 5.4% (61.6% vs 67.0%), respectively. Alterations in p53 represent a highly promising marker of disease recurrence and cancer specific mortality after radical cystectomy for urothelial carcinoma of the bladder. Analysis confirmed previous findings and showed that considering p53 can result in substantial accuracy gains relative to the use of standard predictors. The value and the level of the current evidence clearly exceed previous proof of the independent predictor status of p53 for predicting recurrence and cancer specific mortality.

  4. Selective Resistance of CD44hi T Cells to p53 Dependent Cell Death Results in Persistence of Immunologic Memory after Total Body Irradiation1,2,3

    PubMed Central

    Yao, Zhenyu; Jones, Jennifer; Kohrt, Holbrook; Strober, Samuel

    2011-01-01

    Our previous studies showed that treatment of mice with total body irradiation (TBI) or total lymphoid tissue irradiation (TLI) markedly changes the balance of residual T cell subsets to favor CD4+CD44hi natural killer T (NKT) cells due to differential resistance of the latter subset to cell death. The object of the current study was to further elucidate the changed balance and mechanisms of differential radioresistance of T cell subsets after graded doses of TBI. The experimental results show that CD4+ T cells were markedly more resistant than CD8+ T cells, and CD44hi T cells including NKT cells and memory T cells were markedly more resistant than CD44lo (naïve) T cells. The memory T cells immunized to alloantigens persisted even after myeloabloative (1,000cGy) TBI, and were able to prevent engraftment of bone marrow transplants. Although T cell death after 1,000cGy was prevented in p53−/− mice, there was progressive T cell death in p53−/− mice at higher doses. Whereas, p53 dependent T cell death changed the balance of subsets, the p53 independent T cell death did not. In conclusion, resistance of CD44hi T cells to p53 dependent cell death results in the persistence of immunological memory after TBI, and can explain the immune mediated rejection of marrow transplants in sensitized recipients. PMID:21930972

  5. Addition of interferon-α to the p53-SLP® vaccine results in increased production of interferon-γ in vaccinated colorectal cancer patients: a phase I/II clinical trial.

    PubMed

    Zeestraten, Eliane C M; Speetjens, Frank M; Welters, Marij J P; Saadatmand, Sepideh; Stynenbosch, Linda F M; Jongen, Rogier; Kapiteijn, Ellen; Gelderblom, Hans; Nijman, Hans W; Valentijn, A Rob P M; Oostendorp, Jaap; Fathers, Lorraine M; Drijfhout, Jan W; van de Velde, Cornelis J H; Kuppen, Peter J K; van der Burg, Sjoerd H; Melief, Cornelis J M

    2013-04-01

    We previously established safety and immunogenicity of a p53 synthetic long peptides (p53-SLP®) vaccine. In the current trial, we investigated whether combination of interferon-alpha (IFN-α) with p53-SLP® is both safe and able to improve the induced p53-specific IFN-γ response. Eleven colorectal cancer patients successfully treated for metastatic disease were enrolled in this study. Of these, nine patients completed follow-up after two injections with p53-SLP® together with IFN-α. Safety and p53-specific immune responses were determined before and after vaccination. Furthermore, cryopreserved PBMCs were compared head-to-head to cryopreserved PBMCs obtained in our previous trial with p53-SLP® only. Toxicity of p53-SLP® vaccination in combination with IFN-α was limited to Grade 1 or 2, with predominantly small ongoing swellings at the vaccination site. All patients harbored p53-specific T cells after vaccination and most patients showed p53-specific antibodies. Compared to the previous trial, addition of IFN-α significantly improved the frequency of p53-specific T cells in IFN-γ ELISPOT. Moreover, in this trial, p53-specific T cells were detectable in blood samples of all patients in a direct ex vivo multiparameter flowcytometric assay, opposed to only 2 of 10 patients vaccinated with p53-SLP® only. Finally, patients in this trial displayed a broader p53-specific immunoglobulin-G response, indicating an overall better p53-specific T-helper response. Our study shows that p53-SLP® vaccination combined with IFN-α injection is safe and capable of inducing p53-specific immunity. When compared to a similar trial with p53-SLP® vaccination alone the combination was found to induce significantly more IFN-γ producing p53-specific T cells. Copyright © 2012 UICC.

  6. DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

    PubMed Central

    Polato, Federica; Rusconi, Paolo

    2014-01-01

    Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

  7. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    PubMed

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  8. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    PubMed

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  9. Contribution of herpesvirus specific CD8 T cells to anti-viral T cell response in humans.

    PubMed

    Sandalova, Elena; Laccabue, Diletta; Boni, Carolina; Tan, Anthony T; Fink, Katja; Ooi, Eng Eong; Chua, Robert; Shafaeddin Schreve, Bahar; Ferrari, Carlo; Bertoletti, Antonio

    2010-08-19

    Herpesviruses infect most humans. Their infections can be associated with pathological conditions and significant changes in T cell repertoire but evidences of symbiotic effects of herpesvirus latency have never been demonstrated. We tested the hypothesis that HCMV and EBV-specific CD8 T cells contribute to the heterologous anti-viral immune response. Volume of activated/proliferating virus-specific and total CD8 T cells was evaluated in 50 patients with acute viral infections: 20 with HBV, 12 with Dengue, 12 with Influenza, 3 with Adenovirus infection and 3 with fevers of unknown etiology. Virus-specific (EBV, HCMV, Influenza) pentamer+ and total CD8 T cells were analyzed for activation (CD38/HLA-DR), proliferation (Ki-67/Bcl-2(low)) and cytokine production. We observed that all acute viral infections trigger an expansion of activated/proliferating CD8 T cells, which differs in size depending on the infection but is invariably inflated by CD8 T cells specific for persistent herpesviruses (HCMV/EBV). CD8 T cells specific for other non-related non persistent viral infection (i.e. Influenza) were not activated. IL-15, which is produced during acute viral infections, is the likely contributing mechanism driving the selective activation of herpesvirus specific CD8 T cells. In addition we were able to show that herpesvirus specific CD8 T cells displayed an increased ability to produce the anti-viral cytokine interferon-gamma during the acute phase of heterologous viral infection. Taken together, these data demonstrated that activated herpesvirus specific CD8 T cells inflate the activated/proliferating CD8 T cells population present during acute viral infections in human and can contribute to the heterologous anti-viral T cell response.

  10. Detecting Antigen-Specific T Cell Responses: From Bulk Populations to Single Cells.

    PubMed

    Phetsouphanh, Chansavath; Zaunders, John James; Kelleher, Anthony Dominic

    2015-08-12

    A new generation of sensitive T cell-based assays facilitates the direct quantitation and characterization of antigen-specific T cell responses. Single-cell analyses have focused on measuring the quality and breadth of a response. Accumulating data from these studies demonstrate that there is considerable, previously-unrecognized, heterogeneity. Standard assays, such as the ICS, are often insufficient for characterization of rare subsets of cells. Enhanced flow cytometry with imaging capabilities enables the determination of cell morphology, as well as the spatial localization of the protein molecules within a single cell. Advances in both microfluidics and digital PCR have improved the efficiency of single-cell sorting and allowed multiplexed gene detection at the single-cell level. Delving further into the transcriptome of single-cells using RNA-seq is likely to reveal the fine-specificity of cellular events such as alternative splicing (i.e., splice variants) and allele-specific expression, and will also define the roles of new genes. Finally, detailed analysis of clonally related antigen-specific T cells using single-cell TCR RNA-seq will provide information on pathways of differentiation of memory T cells. With these state of the art technologies the transcriptomics and genomics of Ag-specific T cells can be more definitively elucidated.

  11. Detecting Antigen-Specific T Cell Responses: From Bulk Populations to Single Cells

    PubMed Central

    Phetsouphanh, Chansavath; Zaunders, John James; Kelleher, Anthony Dominic

    2015-01-01

    A new generation of sensitive T cell-based assays facilitates the direct quantitation and characterization of antigen-specific T cell responses. Single-cell analyses have focused on measuring the quality and breadth of a response. Accumulating data from these studies demonstrate that there is considerable, previously-unrecognized, heterogeneity. Standard assays, such as the ICS, are often insufficient for characterization of rare subsets of cells. Enhanced flow cytometry with imaging capabilities enables the determination of cell morphology, as well as the spatial localization of the protein molecules within a single cell. Advances in both microfluidics and digital PCR have improved the efficiency of single-cell sorting and allowed multiplexed gene detection at the single-cell level. Delving further into the transcriptome of single-cells using RNA-seq is likely to reveal the fine-specificity of cellular events such as alternative splicing (i.e., splice variants) and allele-specific expression, and will also define the roles of new genes. Finally, detailed analysis of clonally related antigen-specific T cells using single-cell TCR RNA-seq will provide information on pathways of differentiation of memory T cells. With these state of the art technologies the transcriptomics and genomics of Ag-specific T cells can be more definitively elucidated. PMID:26274954

  12. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

    PubMed

    Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

    2016-11-22

    Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

  13. Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

    PubMed Central

    Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

    2016-01-01

    Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

  14. Antigen specific T-cell responses against tumor antigens are controlled by regulatory T cells in patients with prostate cancer.

    PubMed

    Hadaschik, Boris; Su, Yun; Huter, Eva; Ge, Yingzi; Hohenfellner, Markus; Beckhove, Philipp

    2012-04-01

    Immunotherapy is a promising approach in an effort to control castration resistant prostate cancer. We characterized tumor antigen reactive T cells in patients with prostate cancer and analyzed the suppression of antitumor responses by regulatory T cells. Peripheral blood samples were collected from 57 patients with histologically confirmed prostate cancer, 8 patients with benign prostatic hyperplasia and 16 healthy donors. Peripheral blood mononuclear cells were isolated and antigen specific interferon-γ secretion of isolated T cells was analyzed by enzyme-linked immunospot assay. T cells were functionally characterized and T-cell responses before and after regulatory T-cell depletion were compared. As test tumor antigens, a panel of 11 long synthetic peptides derived from a total of 8 tumor antigens was used, including prostate specific antigen and prostatic acid phosphatase. In patients with prostate cancer we noted a 74.5% effector T-cell response rate compared with only 25% in patients with benign prostatic hyperplasia and 31% in healthy donors. In most patients 2 or 3 tumor antigens were recognized. Comparing various disease stages there was a clear increase in the immune response against prostate specific antigens from intermediate to high risk tumors and castration resistant disease. Regulatory T-cell depletion led to a significant boost in effector T-cell responses against prostate specific antigen and prostatic acid phosphatase. Tumor specific effector T cells were detected in most patients with prostate cancer, especially those with castration resistant prostate cancer. Since effector T-cell responses against prostate specific antigens strongly increased after regulatory T-cell depletion, our results indicate that immunotherapy efficacy could be enhanced by decreasing regulatory T cells. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  15. Induction and function of virus-specific CD4+ T cell responses

    PubMed Central

    Whitmire, Jason K.

    2010-01-01

    CD4+ T cells -- often referred to as T-helper cells -- play a central role in immune defense and pathogenesis. Virus infections and vaccines stimulate and expand populations of antigen-specific CD4+ T cells in mice and in man. These virus-specific CD4+ T cells are extremely important in antiviral protection: deficiencies in CD4+ T cells are associated with virus reactivation, generalized susceptibility to opportunistic infections, and poor vaccine efficacy. As described below, CD4+ T cells influence effector and memory CD8+ T cell responses, humoral immunity, and the antimicrobial activity of macrophages and are involved in recruiting cells to sites of infection. This review summarizes a few key points about the dynamics of the CD4+ T cell response to virus infection, the positive role of pro-inflammatory cytokines in the differentiation of virus-specific CD4+ T cells, and new areas of investigation to improve vaccines against virus infection. PMID:21236461

  16. The simultaneous ex vivo detection of low-frequency antigen-specific CD4+ and CD8+ T-cell responses using overlapping peptide pools.

    PubMed

    Singh, Satwinder Kaur; Meyering, Maaike; Ramwadhdoebe, Tamara H; Stynenbosch, Linda F M; Redeker, Anke; Kuppen, Peter J K; Melief, Cornelis J M; Welters, Marij J P; van der Burg, Sjoerd H

    2012-11-01

    The ability to measure antigen-specific T cells at the single-cell level by intracellular cytokine staining (ICS) is a promising immunomonitoring tool and is extensively applied in the evaluation of immunotherapy of cancer. The protocols used to detect antigen-specific CD8+ T-cell responses generally work for the detection of antigen-specific T cells in samples that have undergone at least one round of in vitro pre-stimulation. Application of a common protocol but now using long peptides as antigens was not suitable to simultaneously detect antigen-specific CD8+ and CD4+ T cells directly ex vivo in cryopreserved samples. CD8 T-cell reactivity to monocytes pulsed with long peptides as antigens ranged between 5 and 25 % of that observed against monocytes pulsed with a direct HLA class I fitting minimal CTL peptide epitope. Therefore, we adapted our ICS protocol and show that the use of tenfold higher concentration of long peptides to load APC, the use of IFN-α and poly(I:C) to promote antigen processing and improve T-cell stimulation, does allow for the ex vivo detection of low-frequency antigen-specific CD8+ and CD4+ T cells in an HLA-independent setting. While most of the improvements were related to increasing the ability to measure CD8+ T-cell reactivity following stimulation with long peptides to at least 50 % of the response detected when using a minimal peptide epitope, the final analysis of blood samples from vaccinated patients successfully showed that the adapted ICS protocol also increases the ability to ex vivo detect low-frequency p53-specific CD4+ T-cell responses in cryopreserved PBMC samples.

  17. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

    PubMed Central

    Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

    2016-01-01

    Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

  18. Fluidity of HIV-1-Specific T-Cell Responses during Acute and Early Subtype C HIV-1 Infection and Associations with Early Disease Progression ▿

    PubMed Central

    Mlotshwa, Mandla; Riou, Catherine; Chopera, Denis; de Assis Rosa, Debra; Ntale, Roman; Treunicht, Florette; Woodman, Zenda; Werner, Lise; van Loggerenberg, Francois; Mlisana, Koleka; Abdool Karim, Salim; Williamson, Carolyn; Gray, Clive M.

    2010-01-01

    Deciphering immune events during early stages of human immunodeficiency virus type 1 (HIV-1) infection is critical for understanding the course of disease. We characterized the hierarchy of HIV-1-specific T-cell gamma interferon (IFN-γ) enzyme-linked immunospot (ELISPOT) assay responses during acute subtype C infection in 53 individuals and associated temporal patterns of responses with disease progression in the first 12 months. There was a diverse pattern of T-cell recognition across the proteome, with the recognition of Nef being immunodominant as early as 3 weeks postinfection. Over the first 6 months, we found that there was a 23% chance of an increased response to Nef for every week postinfection (P = 0.0024), followed by a nonsignificant increase to Pol (4.6%) and Gag (3.2%). Responses to Env and regulatory proteins appeared to remain stable. Three temporal patterns of HIV-specific T-cell responses could be distinguished: persistent, lost, or new. The proportion of persistent T-cell responses was significantly lower (P = 0.0037) in individuals defined as rapid progressors than in those progressing slowly and who controlled viremia. Almost 90% of lost T-cell responses were coincidental with autologous viral epitope escape. Regression analysis between the time to fixed viral escape and lost T-cell responses (r = 0.61; P = 0.019) showed a mean delay of 14 weeks after viral escape. Collectively, T-cell epitope recognition is not a static event, and temporal patterns of IFN-γ-based responses exist. This is due partly to viral sequence variation but also to the recognition of invariant viral epitopes that leads to waves of persistent T-cell immunity, which appears to associate with slower disease progression in the first year of infection. PMID:20826686

  19. Long-term clinical and immunological effects of p53-SLP® vaccine in patients with ovarian cancer.

    PubMed

    Leffers, Ninke; Vermeij, Renee; Hoogeboom, Baukje-Nynke; Schulze, Ute R; Wolf, Rinze; Hamming, Ineke E; van der Zee, Ate G; Melief, Kees J; van der Burg, Sjoerd H; Daemen, Toos; Nijman, Hans W

    2012-01-01

    Vaccine-induced p53-specific immune responses were previously reported to be associated with improved response to secondary chemotherapy in patients with small cell lung cancer. We investigated long-term clinical and immunological effects of the p53-synthetic long peptide (p53-SLP®) vaccine in patients with recurrent ovarian cancer. Twenty patients were immunized with the p53-SLP® vaccine between July 2006 and August 2007. Follow-up information on patients was obtained. Clinical responses to secondary chemotherapy after p53-SLP® immunizations were determined by computerized tomography and/or tumor marker levels (CA125). Disease-specific survival was compared to a matched historical control group. Immune responses were analyzed by flow cytometry, proliferation assay, interferon gamma (IFN-γ) ELISPOT and/or cytokine bead array. Lymphocytes cultured from skin biopsy were analyzed by flow cytometry and proliferation assay. Of 20 patients treated with the p53-SLP® vaccine, 17 were subsequently treated with chemotherapy. Eight of these patients volunteered another blood sample. No differences in clinical response rates to secondary chemotherapy or disease-specific survival were observed between immunized patients and historical controls (p = 0.925, resp. p = 0.601). p53-specific proliferative responses were observed in 5/8 patients and IFN-γ production in 2/7 patients. Lymphocytes cultured from a prior injection site showing inflammation during chemotherapy did not recognize p53-SLP®. Thus, treatment with the p53-SLP® vaccine does not affect responses to secondary chemotherapy or survival, although p53-specific T-cells do survive chemotherapy. Copyright © 2011 UICC.

  20. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    PubMed

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  1. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    PubMed

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  2. p53-regulated autophagy is controlled by glycolysis and determines cell fate

    PubMed Central

    Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

    2015-01-01

    The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

  3. Combined radiation and p53 gene therapy of malignant glioma cells.

    PubMed

    Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

    1999-01-01

    More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We

  4. Aflatoxin B1-induced DNA adduct formation and p53 mutations in CYP450-expressing human liver cell lines.

    PubMed

    Macé, K; Aguilar, F; Wang, J S; Vautravers, P; Gómez-Lechón, M; Gonzalez, F J; Groopman, J; Harris, C C; Pfeifer, A M

    1997-07-01

    Epidemiological evidence has been supporting a relationship between dietary aflatoxin B1 (AFB1) exposure, development of human primary hepatocellular carcinoma (HCC) and mutations in the p53 tumor suppressor gene. However, the correlation between the observed p53 mutations, the AFB1 DNA adducts and their activation pathways has not been elucidated. Development of relevant cellular in vitro models, taking into account species and tissue specificity, could significantly contribute to the knowledge of cytotoxicity and genotoxicity mechanisms of chemical procarcinogens, such as AFB1, in humans. For this purpose a non-tumorigenic SV40-immortalized human liver epithelial cell line (THLE cells) which retained most of the phase II enzymes, but had markedly reduced phase I activities was used for stable expression of the human CYP1A2, CYP2A6, CYP2B6 and CYP3A4 cDNA. The four genetically engineered cell lines (T5-1A2, T5-2A6, T5-2B6 and T5-3A4) produced high levels of the specific CYP450 proteins and showed comparable or higher catalytic activities related to the CYP450 expression when compared to human hepatocytes. The T5-1A2, T5-2A6, T5-2B6 and T5-3A4 cell lines exhibited a very high sensitivity to the cytotoxic effects of AFB1 and were approximately 125-, 2-, 2- and 15-fold, respectively, more sensitive than the control T5-neo cells, transfected with an expressing vector which does not contain CYP450 cDNA. In the CYP450-expressing cells, nanomolar doses of AFB1-induced DNA adduct formation including AFB1-N7-guanine, -pyrimidyl and -diol adducts. In addition, the T5-1A2 cells showed AFM1-DNA adducts. At similar levels of total DNA adducts, both the T5-1A2 and T5-3A4 cells showed, at codon 249 of the p53 gene, AGG to AGT transversions at a relative frequency of 15x10(-6). In contrast, only the T5-3A4 cells showed CCC to ACC transversion at codon 250 at a high frequency, whereas the second most frequent mutations found in the T5-1A2 cells were C to T transitions at the first

  5. Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

    PubMed Central

    Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

    2008-01-01

    Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

  6. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    PubMed Central

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

    2012-01-01

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

  7. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    PubMed

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  8. Potent Cell-Intrinsic Immune Responses in Dendritic Cells Facilitate HIV-1-Specific T Cell Immunity in HIV-1 Elite Controllers.

    PubMed

    Martin-Gayo, Enrique; Buzon, Maria Jose; Ouyang, Zhengyu; Hickman, Taylor; Cronin, Jacqueline; Pimenova, Dina; Walker, Bruce D; Lichterfeld, Mathias; Yu, Xu G

    2015-06-01

    The majority of HIV-1 elite controllers (EC) restrict HIV-1 replication through highly functional HIV-1-specific T cell responses, but mechanisms supporting the evolution of effective HIV-1-specific T cell immunity in these patients remain undefined. Cytosolic immune recognition of HIV-1 in conventional dendritic cells (cDC) can facilitate priming and expansion of HIV-1-specific T cells; however, HIV-1 seems to be able to avoid intracellular immune recognition in cDCs in most infected individuals. Here, we show that exposure of cDCs from EC to HIV-1 leads to a rapid and sustained production of type I interferons and upregulation of several interferon-stimulated effector genes. Emergence of these cell-intrinsic immune responses was associated with a reduced induction of SAMHD1 and LEDGF/p75, and an accumulation of viral reverse transcripts, but inhibited by pharmacological blockade of viral reverse transcription or siRNA-mediated silencing of the cytosolic DNA sensor cGAS. Importantly, improved cell-intrinsic immune recognition of HIV-1 in cDCs from elite controllers translated into stronger abilities to stimulate and expand HIV-1-specific CD8 T cell responses. These data suggest an important role of cell-intrinsic type I interferon secretion in dendritic cells for the induction of effective HIV-1-specific CD8 T cells, and may be helpful for eliciting functional T cell immunity against HIV-1 for preventative or therapeutic clinical purposes.

  9. p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

    PubMed Central

    Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

    2010-01-01

    The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

  10. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

  11. Preserving HIV-specific T cell responses: does timing of antiretroviral therapy help?

    PubMed

    Macatangay, Bernard J C; Rinaldo, Charles R

    2015-01-01

    HIV-specific T cell responses are likely to have an important role in HIV cure strategies that aim for long-lasting viral control without antiretroviral therapy (ART). An important issue in enhancing virus-specific T cell responses is whether timing of ART can influence their magnitude and breadth. Early ART is associated with lower T cell activation, preservation of T cell numbers, smaller DNA and RNA reservoir size, and, in a single study (VISCONTI), control of plasma viremia after treatment interruption. The prevention of T cell destruction by early ART is associated with relatively low anti-HIV CD8⁺ T cell responses but stronger CD4⁺ T helper function. The relatively lower CD8⁺T cell response, which is presumably due to rapid lowering of HIV antigen burden after early ART, appears sufficient to control residual viral replication as well as viral rebound upon treatment interruption. Available evidence of starting ART during acute or early HIV infection has shown benefit in both virologic and immunologic parameters despite the lower HIV-specific CD8⁺ T cell responses observed. Encouraging as this is, more extensive data are necessary to evaluate its role in combination with immunotherapeutic and latency activation strategies that are being assessed in various HIV cure-related studies.

  12. The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

    PubMed

    Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

    2018-03-23

    p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.

    PubMed

    Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D

    2017-08-01

    Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.

  14. Mutant p53 expression in fallopian tube epithelium drives cell migration.

    PubMed

    Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

    2015-10-01

    Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

  15. Therapeutic targeting of regulatory T cells enhances tumor-specific CD8+ T cell responses in Epstein–Barr virus associated nasopharyngeal carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fogg, Mark; Murphy, John R.; Lorch, Jochen

    Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, asmore » well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. - Highlights: • Viral proteins are tumor antigens in Epstein–Barr virus associated Nasopharyngeal Carcinoma. • CD8+ T cell responses against EBV proteins EBNA-1 and LMP2 are suppressed in NPC patients. • T regulatory cells are responsible for suppressing EBV immunity in NPC patients. • Depletion of Tregs with Ontak can rescue EBV-specific CD8+ T cell responses in NPC patients. • This clinically approved drug may be effective for enhancing anti-tumor immunity in NPC patients.« less

  16. Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

    PubMed

    Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

    1998-01-01

    A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

  17. T-Cell-Specific Loss of the PI-3-Kinase p110α Catalytic Subunit Results in Enhanced Cytokine Production and Antitumor Response

    PubMed Central

    Aragoneses-Fenoll, Laura; Ojeda, Gloria; Montes-Casado, María; Acosta-Ampudia, Yeny; Dianzani, Umberto; Portolés, Pilar; Rojo, José M.

    2018-01-01

    Class IA phosphatidylinositol 3-kinase (PI3K) catalytic subunits p110α and p110δ are targets in cancer therapy expressed at high levels in T lymphocytes. The role of p110δ PI3K in normal or pathological immune responses is well established, yet the importance of p110α subunits in T cell-dependent immune responses is not clear. To address this problem, mice with p110α conditionally deleted in CD4+ and CD8+ T lymphocytes (p110α−/−ΔT) were used. p110α−/−ΔT mice show normal development of T cell subsets, but slightly reduced numbers of CD4+ T cells in the spleen. “In vitro,” TCR/CD3 plus CD28 activation of naive CD4+ and CD8+ p110α−/−ΔT T cells showed enhanced effector function, particularly IFN-γ secretion, T-bet induction, and Akt, Erk, or P38 activation. Tfh derived from p110α−/−ΔT cells also have enhanced responses when compared to normal mice, and IL-2 expanded p110α−/−ΔT CD8+ T cells had enhanced levels of LAMP-1 and Granzyme B. By contrast, the expansion of p110α−/−ΔT iTreg cells was diminished. Also, p110α−/−ΔT mice had enhanced anti-keyhole limpet hemocyanin (KLH) IFN-γ, or IL-4 responses and IgG1 and IgG2b anti-KLH antibodies, using CFA or Alum as adjuvant, respectively. When compared to WT mice, p110α−/−ΔT mice inoculated with B16.F10 melanoma showed delayed tumor progression. The percentage of CD8+ T lymphocytes was higher and the percentage of Treg cells lower in the spleen of tumor-bearing p110α−/−ΔT mice. Also, IFN-γ production in tumor antigen-activated spleen cells was enhanced. Thus, PI3K p110α plays a significant role in antigen activation and differentiation of CD4+ and CD8+ T lymphocytes modulating antitumor immunity. PMID:29535720

  18. p53 -Dependent and -Independent Nucleolar Stress Responses

    PubMed Central

    Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.

    2012-01-01

    The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530

  19. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    PubMed

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  20. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    PubMed

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  1. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    PubMed Central

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  2. The tumour suppressor CYLD regulates the p53 DNA damage response

    PubMed Central

    Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

    2016-01-01

    The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

  3. HIV infection impairs Th1 and Th17 Mycobacterium tuberculosis-specific T cell responses

    PubMed Central

    Murray, Lyle W; Satti, Iman; Meyerowitz, Jodi; Jones, Matthew; Willberg, Christian B; Ussher, James E; Goedhals, Dominique; Hurst, Jacob; Phillips, Rodney E; McShane, Helen

    2018-01-01

    Background HIV-infected individuals have a higher risk of developing active tuberculosis than HIV-uninfected individuals, but the mechanisms underpinning this are unclear. We hypothesized that depletion of specific components of Mycobacterium tuberculosis (M.tb)-specific CD4+ and CD8+ T cell responses contributed to this increased risk. Methods M.tb-specific T cell responses in 147 HIV-infected and 44 HIV-uninfected control subjects in a TB-endemic setting in Bloemfontein, South Africa were evaluated. Using a whole-blood flow cytometry assay, we measured expression of IFNγ, TNFα, IL-2 and IL-17 in CD4+ and CD8+ T cells in response to M.tb antigens (PPD, ESAT-6/CFP-10 (EC) and DosR regulon-encoded α-crystallin (Rv2031c)). Results Fewer HIV-infected individuals had detectable CD4+ and CD8+ T cell responses to PPD and Rv2031c than HIV-uninfected subjects. M.tb-specific T cells showed distinct patterns of cytokine expression comprising both Th1 (CD4 and CD8) and Th17 (CD4) cytokines, the latter at highest frequency for Rv2031c. Th17 antigen-specific responses to all antigens tested were specifically impaired in HIV-infected individuals. Conclusions HIV-associated impairment of CD4+ and CD8+ M.tb-specific T cell responses is antigen-specific, particularly impacting responses to PPD and Rv2031c. Preferential depletion of Th17 cytokine-expressing CD4+ T cells suggests this T cell subset may be key to TB susceptibility in HIV-infected individuals. PMID:29546381

  4. Therapeutic targeting of regulatory T cells enhances tumor-specific CD8+ T cell responses in Epstein–Barr virus associated nasopharyngeal carcinoma

    PubMed Central

    Fogg, Mark; Murphy, John R.; Lorch, Jochen; Posner, Marshall; Wang, Fred

    2013-01-01

    Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, as well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. PMID:23601786

  5. Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

    PubMed

    Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

    2005-01-20

    Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

  6. Modeling the Etiology of p53-mutated Cancer Cells*

    PubMed Central

    Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

    2016-01-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

  7. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    PubMed Central

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  8. Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

    PubMed

    Burger, C; Fanning, E

    1983-04-15

    Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

  9. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

    PubMed

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

    2002-08-22

    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  10. The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment

    PubMed Central

    Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

    2016-01-01

    Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53−/− cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin. PMID:27626169

  11. The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment.

    PubMed

    Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

    2016-10-25

    Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.

  12. In vitro generation of helper T cells and suppressor T cells that regulate the cytolytic T lymphocyte response to trinitrophenyl-modified syngeneic cells.

    PubMed

    Gualde, N; Weinberger, O; Ratnofsky, S; Benacerraf, B; Burakoff, S J

    1982-04-01

    Helper T cells and suppressor T cells have been generated in vitro that regulate the cytolytic T lymphocyte (CTL) response to trinitrophenyl (TNP)-modified syngeneic cells. B6D2F1 helper cells generated to TNP-modified parental (P1) cells augment the CTL response to those P1-TNP-modified antigens but not to P2-TNP-modified antigens. The generation of these helper T cells requires the presence of splenic adherent cells and these helper T cells are radioresistant. A soluble factor can be obtained from the helper T cell cultures that can also augment the CTL response. The suppressor T cells generated in culture do not demonstrate the specificity observed with the helper T cells; however, they are antigen-dependent in their induction. Whether helper or suppressor activity is obtained depends upon the length of time cells are cultured in vitro.

  13. In vitro generation of helper T cells and suppressor T cells that regulate the cytolytic T lymphocyte response to trinitrophenyl-modified syngeneic cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gualde, N.; Weinberger, O.; Ratnofsky, S.

    1982-04-01

    Helper T cells and suppressor T cells have been generated in vitro that regulate the cytolytic T lymphocyte (CTL) response to trinitrophenyl (TNP)-modified syngeneic cells. B6D2F1 helper cells generated to TNP-modified parental (P1) cells augment the CTL response to those P1-TNP-modified antigens but not to P2-TNP-modified antigens. The generation of these helper T cells requires the presence of splenic adherent cells and these helper T cells are radioresistant. A soluble factor can be obtained from the helper T cell cultures that can also augment the CTL response. The suppressor T cells generated in culture do not demonstrate the specificity observedmore » with the helper T cells; however, they are antigen-dependent in their induction. Whether helper or suppressor activity is obtained depends upon the length of time cells are cultured in vitro.« less

  14. P53 protein in proliferation, repair and apoptosis of cells.

    PubMed

    Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

    2014-05-01

    The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

  15. HIV-1 Antibody Neutralization Breadth Is Associated with Enhanced HIV-Specific CD4+ T Cell Responses

    PubMed Central

    Soghoian, Damien Z.; Lindqvist, Madelene; Ghebremichael, Musie; Donaghey, Faith; Carrington, Mary; Seaman, Michael S.; Kaufmann, Daniel E.; Walker, Bruce D.

    2015-01-01

    ABSTRACT Antigen-specific CD4+ T helper cell responses have long been recognized to be a critical component of effective vaccine immunity. CD4+ T cells are necessary to generate and maintain humoral immune responses by providing help to antigen-specific B cells for the production of antibodies. In HIV infection, CD4+ T cells are thought to be necessary for the induction of Env-specific broadly neutralizing antibodies. However, few studies have investigated the role of HIV-specific CD4+ T cells in association with HIV neutralizing antibody activity in vaccination or natural infection settings. Here, we conducted a comprehensive analysis of HIV-specific CD4+ T cell responses in a cohort of 34 untreated HIV-infected controllers matched for viral load, with and without neutralizing antibody breadth to a panel of viral strains. Our results show that the breadth and magnitude of Gag-specific CD4+ T cell responses were significantly higher in individuals with neutralizing antibodies than in those without neutralizing antibodies. The breadth of Gag-specific CD4+ T cell responses was positively correlated with the breadth of neutralizing antibody activity. Furthermore, the breadth and magnitude of gp41-specific, but not gp120-specific, CD4+ T cell responses were significantly elevated in individuals with neutralizing antibodies. Together, these data suggest that robust Gag-specific CD4+ T cells and, to a lesser extent, gp41-specific CD4+ T cells may provide important intermolecular help to Env-specific B cells that promote the generation or maintenance of Env-specific neutralizing antibodies. IMPORTANCE One of the earliest discoveries related to CD4+ T cell function was their provision of help to B cells in the development of antibody responses. Yet little is known about the role of CD4+ T helper responses in the setting of HIV infection, and no studies to date have evaluated the impact of HIV-specific CD4+ T cells on the generation of antibodies that can neutralize

  16. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    PubMed

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Age-associated Epstein–Barr virus-specific T cell responses in seropositive healthy adults

    PubMed Central

    Cárdenas Sierra, D; Vélez Colmenares, G; Orfao de Matos, A; Fiorentino Gómez, S; Quijano Gómez, S M

    2014-01-01

    Epstein–Barr virus (EBV) is present in 95% of the world's adult population. The immune response participates in immune vigilance and persistent infection control, and this condition is maintained by both a good quality (functionality) and quantity of specific T cells throughout life. In the present study, we evaluated EBV-specific CD4+ and CD8+ T lymphocyte responses in seropositive healthy individuals younger and older than 50 years of age. The assessment comprised the frequency, phenotype, functionality and clonotypic distribution of T lymphocytes. We found that in both age groups a similar EBV-specific T cell response was found, with overlapping numbers of tumour necrosis factor (TNF)-α+ T lymphocytes (CD4+ and CD8+) within the memory and effector cell compartments, in addition to monofunctional and multi-functional T cells producing interleukin (IL)-2 and/or interferon (IFN)-γ. However, individuals aged more than 50 years showed significantly higher frequencies of IL-2-producing CD4+ T lymphocytes in association with greater production of soluble IFN-γ, TNF-α and IL-6 than subjects younger than 50 years. A polyclonal T cell receptor (TCR)-variable beta region (Vβ) repertoire exists in both age groups under basal conditions and in response to EBV; the major TCR families found in TNF-α+/CD4+ T lymphocytes were Vβ1, Vβ2, Vβ17 and Vβ22 in both age groups, and the major TCR family in TNF-α+/CD8+ T cells was Vβ13·1 for individuals younger than 50 years and Vβ9 for individuals aged more than 50 years. Our findings suggest that the EBV-specific T cell response (using a polyclonal stimulation model) is distributed throughout several T cell differentiation compartments in an age-independent manner and includes both monofunctional and multi-functional T lymphocytes. PMID:24666437

  18. Hepatitis C Virus Induces Regulatory T Cells by Naturally Occurring Viral Variants to Suppress T Cell Responses

    PubMed Central

    Cusick, Matthew F.; Schiller, Jennifer J.; Gill, Joan C.; Eckels, David D.

    2011-01-01

    Regulatory T cell markers are increased in chronically infected individuals with the hepatitis C virus (HCV), but to date, the induction and maintenance of Tregs in HCV infection has not been clearly defined. In this paper, we demonstrate that naturally occurring viral variants suppress T cell responses to cognate NS3358-375 in an antigen-specific manner. Of four archetypal variants, S370P induced regulatory T cell markers in comparison to NS3358-375-stimulated CD4 T cells. Further, the addition of variant-specific CD4 T cells back into a polyclonal culture in a dose-dependent manner inhibited the T cell response. These results suggest that HCV is able to induce antigen-specific regulatory T cells to suppress the antiviral T cell response in an antigen-specific manner, thus contributing to a niche within the host that could be conducive to HCV persistence. PMID:21197453

  19. The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

    PubMed Central

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

  20. Increased Arf/p53 activity in stem cells, aging and cancer.

    PubMed

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  1. Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei.

    PubMed

    Nuñez-Hernandez, Dahlia M; Felix-Portillo, Monserrath; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

    2018-01-01

    Although hypoxic aquatic environments cause negative effects on shrimp, these animals can withstand somewhat hypoxia, but the cellular mechanisms underlying this capacity are still poorly understood. In humans, mild hypoxia causes the induction of many proteins to allow cell survival. In contrast, apoptosis is induced during severe hypoxia leading to cell death. p53 is a key transcription factor that determines cells fate towards cell cycle arrest or induction of apoptosis in humans. The aim of this work was to study the role of p53 in cell cycle regulation and apoptosis in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. p53 was silenced by RNAi and afterwards the shrimp were exposed to hypoxia. Cdk-2 was used as indicator of cell cycle progression while caspase-3 expression and caspase activity were analyzed as indicators of apoptosis. p53 levels in hepatopancreas were significantly higher at 48 h after hypoxic treatment. Increased expression levels of Cdk-2 were found in p53-silenced shrimp after 24 and 48 h in the normoxic treatments as well as 48 h after hypoxia, indicating a possible role of p53 in cell cycle regulation. In response to hypoxia, unsilenced shrimp showed an increase in caspase-3 expression levels, however an increase was also observed in caspase activity at 24 h of normoxic conditions in p53-silenced shrimps. Taken together these results indicate the involvement of p53 in regulation of cell cycle and apoptosis in the white shrimp in response to hypoxia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Mucorales-Specific T Cells in Patients with Hematologic Malignancies

    PubMed Central

    Forghieri, Fabio; Candoni, Anna; Cesaro, Simone; Quadrelli, Chiara; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Codeluppi, Mauro; Mussini, Cristina; Colaci, Elisabetta; Messerotti, Andrea; Paolini, Ambra; Maccaferri, Monica; Fantuzzi, Valeria; Del Giovane, Cinzia; Stefani, Alessandro; Morandi, Uliano; Maffei, Rossana; Marasca, Roberto; Narni, Franco; Fanin, Renato; Comoli, Patrizia; Romani, Luigina; Beauvais, Anne; Viale, Pier Luigi; Latgè, Jean Paul; Luppi, Mario

    2016-01-01

    Background Invasive mucormycosis (IM) is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients. Methods and Findings By using an enzyme linked immunospot assay, the presence of Mucorales-specific T cells in peripheral blood (PB) samples has been investigated at three time points during high-dose chemotherapy for hematologic malignancies. Mucorales-specific T cells producing interferon-γ, interleukin-10 and interleukin-4 were analysed in order to detect a correlation between the immune response and the clinical picture. Twenty-one (10.3%) of 204 patients, accounting for 32 (5.3%) of 598 PB samples, tested positive for Mucorales-specific T cells. Two groups could be identified. Group 1, including 15 patients without signs or symptoms of invasive fungal diseases (IFD), showed a predominance of Mucorales-specific T cells producing interferon-gamma. Group 2 included 6 patients with a clinical picture consistent with invasive fungal disease (IFD): 2 cases of proven IM and 4 cases of possible IFD. The proven patients had significantly higher number of Mucorales-specific T cells producing interleukin-10 and interleukin-4 and higher rates of positive samples by using derived diagnostic cut-offs when compared with the 15 patients without IFD. Conclusions Mucorales-specific T cells can be detected and monitored in patients with hematologic malignancies at risk for IM. Mucorales-specific T cells polarized to the production of T helper type 2 cytokines are associated with proven IM and may be evaluated as a surrogate diagnostic marker for IM. PMID:26871570

  3. Mucorales-Specific T Cells in Patients with Hematologic Malignancies.

    PubMed

    Potenza, Leonardo; Vallerini, Daniela; Barozzi, Patrizia; Riva, Giovanni; Gilioli, Andrea; Forghieri, Fabio; Candoni, Anna; Cesaro, Simone; Quadrelli, Chiara; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Codeluppi, Mauro; Mussini, Cristina; Colaci, Elisabetta; Messerotti, Andrea; Paolini, Ambra; Maccaferri, Monica; Fantuzzi, Valeria; Del Giovane, Cinzia; Stefani, Alessandro; Morandi, Uliano; Maffei, Rossana; Marasca, Roberto; Narni, Franco; Fanin, Renato; Comoli, Patrizia; Romani, Luigina; Beauvais, Anne; Viale, Pier Luigi; Latgè, Jean Paul; Lewis, Russell E; Luppi, Mario

    2016-01-01

    Invasive mucormycosis (IM) is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients. By using an enzyme linked immunospot assay, the presence of Mucorales-specific T cells in peripheral blood (PB) samples has been investigated at three time points during high-dose chemotherapy for hematologic malignancies. Mucorales-specific T cells producing interferon-γ, interleukin-10 and interleukin-4 were analysed in order to detect a correlation between the immune response and the clinical picture. Twenty-one (10.3%) of 204 patients, accounting for 32 (5.3%) of 598 PB samples, tested positive for Mucorales-specific T cells. Two groups could be identified. Group 1, including 15 patients without signs or symptoms of invasive fungal diseases (IFD), showed a predominance of Mucorales-specific T cells producing interferon-gamma. Group 2 included 6 patients with a clinical picture consistent with invasive fungal disease (IFD): 2 cases of proven IM and 4 cases of possible IFD. The proven patients had significantly higher number of Mucorales-specific T cells producing interleukin-10 and interleukin-4 and higher rates of positive samples by using derived diagnostic cut-offs when compared with the 15 patients without IFD. Mucorales-specific T cells can be detected and monitored in patients with hematologic malignancies at risk for IM. Mucorales-specific T cells polarized to the production of T helper type 2 cytokines are associated with proven IM and may be evaluated as a surrogate diagnostic marker for IM.

  4. P53 Immune Responses in Breast Cancer Patients: Assessment of CTL Recognizing the HLA-A2.1 Restricted, Wild-type Sequence p53 (264-272) Epitope; Frequencies of Tetramer+ T Cells Specific for the Wild-Type Sequence P53 (264-272) Peptide in the Circulation of Patients with Head and Neck Cancer; The Ability of Variant Peptides to Reverse the Nonresponsiveness of T Lymphocytes to the Wild-Type Sequence P53 (264-272) Epitope

    DTIC Science & Technology

    2002-10-01

    This document contains three papers focusing on the analysis of anti-p53 cellular immune responses of breast, head, neck, and oral cancer patients...variants were generated by amino acid exchanges at positions 6 (6T) and 7 (7W) of the peptide. The 7W variant peptide has potential for immunotherapy of nonresponsive oral cancer patients.

  5. Identification of Pertussis-Specific Effector Memory T Cells in Preschool Children

    PubMed Central

    Schure, Rose-Minke; Öztürk, Kemal; Berbers, Guy; Sanders, Elisabeth; van Twillert, Inonge; Carollo, Maria; Mascart, Françoise; Ausiello, Clara M.; van Els, Cecile A. C. M.; Smits, Kaat; Buisman, Anne-Marie

    2015-01-01

    Whooping cough remains a problem despite vaccination, and worldwide resurgence of pertussis is evident. Since cellular immunity plays a role in long-term protection against pertussis, we studied pertussis-specific T-cell responses. Around the time of the preschool acellular pertussis (aP) booster dose at 4 years of age, T-cell memory responses were compared in children who were primed during infancy with either a whole-cell pertussis (wP) or an aP vaccine. Peripheral blood mononuclear cells (PBMCs) were isolated and stimulated with pertussis vaccine antigens for 5 days. T cells were characterized by flow-based analysis of carboxyfluorescein succinimidyl ester (CFSE) dilution and CD4, CD3, CD45RA, CCR7, gamma interferon (IFN-γ), and tumor necrosis factor alpha (TNF-α) expression. Before the aP preschool booster vaccination, both the proliferated pertussis toxin (PT)-specific CD4+ and CD8+ T-cell fractions (CFSEdim) were higher in aP- than in wP-primed children. Post-booster vaccination, more pertussis-specific CD4+ effector memory cells (CD45RA− CCR7−) were induced in aP-primed children than in those primed with wP. The booster vaccination did not appear to significantly affect the T-cell memory subsets and functionality in aP-primed or wP-primed children. Although the percentages of Th1 cytokine-producing cells were alike in aP- and wP-primed children pre-booster vaccination, aP-primed children produced more Th1 cytokines due to higher numbers of proliferated pertussis-specific effector memory cells. At present, infant vaccinations with four aP vaccines in the first year of life result in pertussis-specific CD4+ and CD8+ effector memory T-cell responses that persist in children until 4 years of age and are higher than those in wP-primed children. The booster at 4 years of age is therefore questionable; this may be postponed to 6 years of age. PMID:25787136

  6. Modulation of the poly (ADP-ribose) polymerase inhibitor response and DNA recombination in breast cancer cells by drugs affecting endogenous wild-type p53.

    PubMed

    Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa

    2014-10-01

    Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Polyomavirus BK-specific CD8+ T cell responses in patients after allogeneic stem cell transplant.

    PubMed

    Schneidawind, Dominik; Schmitt, Anita; Wiesneth, Markus; Mertens, Thomas; Bunjes, Donald; Freund, Mathias; Schmitt, Michael

    2010-06-01

    Polyomavirus BK (BKV) is known as an important etiologic agent in the development of hemorrhagic cystitis (HC) after allogeneic stem cell transplant (SCT). To define T cell epitopes of the BKV proteins VP1 and sT, eight potential HLA-A2-binding peptides were synthesized based on computer algorithms. These peptides were co-incubated with CD8 + T cells from the peripheral blood (PB) of 25 healthy volunteers and seven patients suffering from HC after allogeneic SCT in a mixed-lymphocyte peptide culture (MLPC), which were subsequently screened by enzyme-linked immunospot (ELISPOT) assays and fluorescence-activated cell sorting (FACS) analysis. We found that CD8 + T cells from five of seven (71%) patients with HC presensitized with the BKV peptide VP1 p108 (LLMWEAVTV) specifically recognized T2 cells pulsed with VP1 p108. In contrast, only seven of 25 (28%) healthy volunteers had CD8 + T cells reactive with VP1 p108-pulsed T2 cells. The presence of VP1 p108-specific T cells could be confirmed by FACS analysis. The BKV peptide VP1 p108 seems to play an important role as an immunodominant peptide in the pathogenesis of HC in patients after allogeneic SCT, and might be a promising target for immunotherapies or even strategies to prevent the development of BKV-associated HC.

  8. Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

    PubMed

    Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

    2009-04-15

    The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

  9. Complex of simian virus 40 large-T antigen and host 53,000-molecular-weight protein in monkey cells.

    PubMed Central

    Harlow, E; Pim, D C; Crawford, L V

    1981-01-01

    Mouse cells transformed by simian virus 40 (SV40) have been shown to contain a complex of the virus-coded large-T antigen with a host 53,000-molecular-weight (53K) protein. Initial attempts to detect a similar complex in lytically infected cells were unsuccessful, and it therefore seemed that the complex might be peculiar to transformed or abortively transformed nonpermissive cells. Immunoprecipitation of [32P]phosphate-labeled extracts of SV40-infected CV-1 African green monkey kidney cells with antibodies specific for large-T or the 53K protein revealed that the large-T-53K protein complex was formed during lytic infections. Only a minor fraction of the large-T present was associated with 53K protein, and large-T and the 53K host protein cosedimented during centrifugation through sucrose gradients. We used monospecific sera and monoclonal antibodies to study the rate of synthesis and phosphorylation of the 53K protein during lytic infections. Infection of CV-1 cells with SV40 increased the rate of synthesis of the 53K protein fivefold over that in mock-infected cells. At the same time, the rate of phosphorylation of the 53K protein increased more than 30-fold compared with control cultures. Monkey cells transformed by UV-irradiated SV40 (Gluzman et al., J. Virol. 22:256-266, 1977) also contained the large-T-53K protein complex. The formation of the complex is therefore not a peculiarity of SV40-transformed rodent cells but is a common feature of SV40 infections. Images PMID:6163871

  10. Preserved immune functionality and high CMV-specific T-cell responses in HIV-infected individuals with poor CD4+ T-cell immune recovery.

    PubMed

    Gómez-Mora, Elisabet; García, Elisabet; Urrea, Victor; Massanella, Marta; Puig, Jordi; Negredo, Eugenia; Clotet, Bonaventura; Blanco, Julià; Cabrera, Cecilia

    2017-09-15

    Poor CD4 + T-cell recovery after cART has been associated with skewed T-cell maturation, inflammation and immunosenescence; however, T-cell functionality in those individuals has not been fully characterized. In the present study, we assessed T-cell function by assessing cytokine production after polyclonal, CMV and HIV stimulations of T-cells from ART-suppressed HIV-infected individuals with CD4 + T-cell counts >350 cells/μL (immunoconcordants) or <350 cells/μL (immunodiscordants). A group of HIV-uninfected individuals were also included as controls. Since CMV co-infection significantly affected T-cell maturation and polyfunctionality, only CMV + individuals were analyzed. Despite their reduced and skewed CD4 + T-cell compartment, immunodiscordant individuals showed preserved polyclonal and HIV-specific responses. However, CMV response in immunodiscordant participants was significantly different from immunoconcordant or HIV-seronegative individuals. In immunodiscordant subjects, the magnitude of IFN-γ + CD8 + and IL-2 + CD4 + T-cells in response to CMV was higher and differently associated with the CD4 + T-cell maturation profile., showing an increased frequency of naïve, central memory and EMRA CMV-specific CD4 + T-cells. In conclusion, CD4 + and CD8 + T-cell polyfunctionality was not reduced in immunodiscordant individuals, although heightened CMV-specific immune responses, likely related to subclinical CMV reactivations, may be contributing to the skewed T-cell maturation and the higher risk of clinical progression observed in those individuals.

  11. Local not systemic modulation of dendritic cell S1P receptors in lung blunts virus-specific immune responses to influenza

    PubMed Central

    Marsolais, David; Hahm, Bumsuk; Edelmann, Kurt H.; Walsh, Kevin B.; Guerrero, Miguel; Hatta, Yasuko; Kawaoka, Yoshihiro; Roberts, Edward; Oldstone, Michael B. A.; Rosen, Hugh

    2008-01-01

    The mechanism by which locally delivered sphingosine analogs regulate host response to localized viral infection has never been addressed. In this report, we show that intra-tracheal (i.t.) delivery of chiral sphingosine analog AAL-R or its phosphate ester inhibits the T cell response to influenza-virus infection. In contrast, neither intra-peritoneal (i.p.) delivery of AAL-R nor i.t. instillation of the non-phosphorylable stereoisomer AAL-S suppressed virus-specific T cell response, indicating that in vivo phosphorylation of AAL-R and S1P receptor modulation in lungs are essential for immunomodulation. I.t. delivery of water soluble S1P1 receptor agonist at doses sufficient to induce systemic lymphopenia did not inhibit virus-specific T cell response indicating that S1P1 is not involved in the immunosuppressive activities of AAL-R and that immunosuppression acts independently of naïve lymphocyte recirculation. Accumulation of dendritic cells (DCs) in draining lymph nodes was inhibited by i.t. but not i.p. delivery of AAL-R. Direct modulation of DCs is demonstrated by the impaired ability of virus-infected bone-marrow derived DCs treated in vitro with AAL-R to trigger in vivo T cell response after adoptive transfer to the airways. Thus, our results suggest that locally delivered sphingosine analogs induce immunosuppression by modulating S1P receptors other than S1P1 or S1P2 on dendritic cells in the lungs after influenza virus infection. PMID:18577684

  12. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  13. Modular nucleic acid assembled p/MHC microarrays for multiplexed sorting of antigen-specific T cells.

    PubMed

    Kwong, Gabriel A; Radu, Caius G; Hwang, Kiwook; Shu, Chengyi J; Ma, Chao; Koya, Richard C; Comin-Anduix, Begonya; Hadrup, Sine Reker; Bailey, Ryan C; Witte, Owen N; Schumacher, Ton N; Ribas, Antoni; Heath, James R

    2009-07-22

    The human immune system consists of a large number of T cells capable of recognizing and responding to antigens derived from various sources. The development of peptide-major histocompatibility (p/MHC) tetrameric complexes has enabled the direct detection of these antigen-specific T cells. With the goal of increasing throughput and multiplexing of T cell detection, protein microarrays spotted with defined p/MHC complexes have been reported, but studies have been limited due to the inherent instability and reproducibility of arrays produced via conventional spotted methods. Herein, we report on a platform for the detection of antigen-specific T cells on glass substrates that offers significant advantages over existing surface-bound schemes. In this approach, called "Nucleic Acid Cell Sorting (NACS)", single-stranded DNA oligomers conjugated site-specifically to p/MHC tetramers are employed to immobilize p/MHC tetramers via hybridization to a complementary-printed substrate. Fully assembled p/MHC arrays are used to detect and enumerate T cells captured from cellular suspensions, including primary human T cells collected from cancer patients. NACS arrays outperform conventional spotted arrays assessed in key criteria such as repeatability and homogeneity. The versatility of employing DNA sequences for cell sorting is exploited to enable the programmed, selective release of target populations of immobilized T cells with restriction endonucleases for downstream analysis. Because of the performance, facile and modular assembly of p/MHC tetramer arrays, NACS holds promise as a versatile platform for multiplexed T cell detection.

  14. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Jiawen; Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg; Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involvedmore » in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response

  15. Accumulation of p53 in infectious mononucleosis tissues.

    PubMed

    Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

    2000-11-01

    Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

  16. The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

    PubMed

    Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

    2018-05-01

    In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Potentiation of a p53-SLP vaccine by cyclophosphamide in ovarian cancer: a single-arm phase II study.

    PubMed

    Vermeij, Renee; Leffers, Ninke; Hoogeboom, Baukje-Nynke; Hamming, Ineke L E; Wolf, Rinze; Reyners, Anna K L; Molmans, Barbara H W; Hollema, Harry; Bart, Joost; Drijfhout, Jan W; Oostendorp, Jaap; van der Zee, Ate G J; Melief, Cornelis J; van der Burg, Sjoerd H; Daemen, Toos; Nijman, Hans W

    2012-09-01

    The purpose of the current phase II single-arm clinical trial was to evaluate whether pretreatment with low-dose cyclophosphamide improves immunogenicity of a p53-synthetic long peptide (SLP) vaccine in patients with recurrent ovarian cancer. Patients with ovarian cancer with elevated serum levels of CA-125 after primary treatment were immunized four times with the p53-SLP vaccine. Each immunization was preceded by administration of 300 mg/m2 intravenous cyclophosphamide as a means to affect regulatory T cells (Tregs). Vaccine-induced p53-specific interferon-gamma (IFN-γ)-producing T cells evaluated by IFN-γ ELISPOT were observed in 90% (9/10) and 87.5% (7/8) of evaluable patients after two and four immunizations, respectively. Proliferative p53-specific T cells, observed in 80.0% (8/10) and 62.5% (5/8) of patients, produced both T-helper 1 and T-helper-2 cytokines. Cyclophosphamide induced neither a quantitative reduction of Tregs determined by CD4+ FoxP3+ T cell levels nor a demonstrable qualitative difference in Treg function tested in vitro. Nonetheless, the number of vaccine-induced p53-specific IFN-γ-producing T cells was higher in our study compared to a study in which a similar patient group was treated with p53-SLP monotherapy (p≤0.012). Furthermore, the strong reduction in the number of circulating p53-specific T cells observed previously after four immunizations was currently absent. Stable disease was observed in 20.0% (2/10) of patients, and the remainder of patients (80.0%) showed clinical, biochemical and/or radiographic evidence of progressive disease. The outcome of this phase II trial warrants new studies on the use of low-dose cyclophosphamide to potentiate the immunogenicity of the p53-SLP vaccine or other antitumor vaccines. Copyright © 2011 UICC.

  18. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    PubMed

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  19. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Detailed analysis of Epstein–Barr virus-specific CD4+ and CD8+ T cell responses during infectious mononucleosis

    PubMed Central

    Scherrenburg, J; Piriou, E R W A N; Nanlohy, N M; van Baarle, D

    2008-01-01

    We studied simultaneously Epstein–Barr virus (EBV)-specific CD4+ and CD8+ T cell responses during and after infectious mononucleosis (IM), using a previously described 12-day stimulation protocol with EBNA1 or BZLF1 peptide pools. Effector function of EBV-specific T cells was determined after restimulation by measuring intracellular interferon-γ production. During IM, BZLF1-specifc CD4+ T cell responses were dominant compared with CD8+ T cell responses. EBNA1-specific CD4+ and CD8+ T cell responses were low and remained similar for 6 months. However, 6 months after IM, BZLF1-specific CD4+ T cell responses had declined, but CD8+ T cell responses had increased. At diagnosis, EBV-specific CD8+ T cells as studied by human leucocyte antigen class I tetramer staining comprised a tetramerbrightCD8bright population consisting mainly of CD27+ memory T cells and a tetramerdimCD8dim population consisting primarily of CD27- effector T cells. The remaining EBV-specific CD8+ T cell population 6 months after the diagnosis of IM consisted mainly of tetramerbrightCD8bright CD27+ T cells, suggesting preferential preservation of memory T cells after contraction of the EBV-specific T cell pool. PMID:18549439

  1. Mycobacterium tuberculosis specific CD8(+) T cells rapidly decline with antituberculosis treatment.

    PubMed

    Nyendak, Melissa R; Park, Byung; Null, Megan D; Baseke, Joy; Swarbrick, Gwendolyn; Mayanja-Kizza, Harriet; Nsereko, Mary; Johnson, Denise F; Gitta, Phineas; Okwera, Alphonse; Goldberg, Stefan; Bozeman, Lorna; Johnson, John L; Boom, W Henry; Lewinsohn, Deborah A; Lewinsohn, David M

    2013-01-01

    Biomarkers associated with response to therapy in tuberculosis could have broad clinical utility. We postulated that the frequency of Mycobacterium tuberculosis (Mtb) specific CD8(+) T cells, by virtue of detecting intracellular infection, could be a surrogate marker of response to therapy and would decrease during effective antituberculosis treatment. We sought to determine the relationship of Mtb specific CD4(+) T cells and CD8(+) T cells with duration of antituberculosis treatment. We performed a prospective cohort study, enrolling between June 2008 and August 2010, of HIV-uninfected Ugandan adults (n = 50) with acid-fast bacillus smear-positive, culture confirmed pulmonary TB at the onset of antituberculosis treatment and the Mtb specific CD4(+) and CD8(+) T cell responses to ESAT-6 and CFP-10 were measured by IFN-γ ELISPOT at enrollment, week 8 and 24. There was a significant difference in the Mtb specific CD8(+) T response, but not the CD4(+) T cell response, over 24 weeks of antituberculosis treatment (p<0.0001), with an early difference observed at 8 weeks of therapy (p = 0.023). At 24 weeks, the estimated Mtb specific CD8(+) T cell response decreased by 58%. In contrast, there was no significant difference in the Mtb specific CD4(+) T cell during the treatment. The Mtb specific CD4(+) T cell response, but not the CD8(+) response, was negatively impacted by the body mass index. Our data provide evidence that the Mtb specific CD8(+) T cell response declines with antituberculosis treatment and could be a surrogate marker of response to therapy. Additional research is needed to determine if the Mtb specific CD8(+) T cell response can detect early treatment failure, relapse, or to predict disease progression.

  2. Mycobacterium tuberculosis Specific CD8+ T Cells Rapidly Decline with Antituberculosis Treatment

    PubMed Central

    Nyendak, Melissa R.; Park, Byung; Null, Megan D.; Baseke, Joy; Swarbrick, Gwendolyn; Mayanja-Kizza, Harriet; Nsereko, Mary; Johnson, Denise F.; Gitta, Phineas; Okwera, Alphonse; Goldberg, Stefan; Bozeman, Lorna; Johnson, John L.; Boom, W. Henry; Lewinsohn, Deborah A.; Lewinsohn, David M.

    2013-01-01

    Rationale Biomarkers associated with response to therapy in tuberculosis could have broad clinical utility. We postulated that the frequency of Mycobacterium tuberculosis (Mtb) specific CD8+ T cells, by virtue of detecting intracellular infection, could be a surrogate marker of response to therapy and would decrease during effective antituberculosis treatment. Objectives: We sought to determine the relationship of Mtb specific CD4+ T cells and CD8+ T cells with duration of antituberculosis treatment. Materials and Methods We performed a prospective cohort study, enrolling between June 2008 and August 2010, of HIV-uninfected Ugandan adults (n = 50) with acid-fast bacillus smear-positive, culture confirmed pulmonary TB at the onset of antituberculosis treatment and the Mtb specific CD4+ and CD8+ T cell responses to ESAT-6 and CFP-10 were measured by IFN-γ ELISPOT at enrollment, week 8 and 24. Results There was a significant difference in the Mtb specific CD8+ T response, but not the CD4+ T cell response, over 24 weeks of antituberculosis treatment (p<0.0001), with an early difference observed at 8 weeks of therapy (p = 0.023). At 24 weeks, the estimated Mtb specific CD8+ T cell response decreased by 58%. In contrast, there was no significant difference in the Mtb specific CD4+ T cell during the treatment. The Mtb specific CD4+ T cell response, but not the CD8+ response, was negatively impacted by the body mass index. Conclusions Our data provide evidence that the Mtb specific CD8+ T cell response declines with antituberculosis treatment and could be a surrogate marker of response to therapy. Additional research is needed to determine if the Mtb specific CD8+ T cell response can detect early treatment failure, relapse, or to predict disease progression. PMID:24324704

  3. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  4. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    PubMed

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.

    PubMed

    Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana

    2013-08-01

    Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.

  6. Pathogen-Specific T Cell Polyfunctionality Is a Correlate of T Cell Efficacy and Immune Protection

    PubMed Central

    Boyd, Anders; Almeida, Jorge R.; Darrah, Patricia A.; Sauce, Delphine; Seder, Robert A.; Appay, Victor; Gorochov, Guy; Larsen, Martin

    2015-01-01

    Introduction Understanding the factors that delineate the efficacy of T cell responses towards pathogens is crucial for our ability to develop potent therapies against infectious diseases. Multidimensional evaluation of T cell functionality at the single-cell level enables exhaustive analysis of combinatorial functional properties, hence polyfunctionality. We have recently invented an algorithm that quantifies polyfunctionality, the Polyfunctionality Index (Larsen et al. PLoS One 2012). Here we demonstrate that quantitative assessment of T cell polyfunctionality correlates with T cell efficacy measured as the capacity to kill target cells in vitro and control infection in vivo. Methods We employed the polyfunctionality index on two datasets selected for their unique ability to evaluate the polyfunctional imprint on T cell efficacy. 1) HIV-specific CD8+ T cells and 2) Leishmania major-specific CD4+ T cells were analysed for their capacity to secrete multiple effector molecules, kill target cells and control infection. Briefly, employing the Polyfunctionality Index algorithm we determined the parameter estimates resulting in optimal correlation between T cell polyfunctionality and T cell efficacy. Results T cell polyfunctionality is correlated with T cell efficacy measured as 1) target killing (r=0.807, P<0.0001) and 2) lesion size upon challenge with Leishmania major (r=-0.50, P=0.004). Contrary to an approach relying on the Polyfunctionality Index algorithm, quantitative evaluation of T cell polyfunctionality traditionally ignores the gradual contribution of more or less polyfunctional T cells. Indeed, comparing both approaches we show that optimal description of T cell efficacy is obtained when gradually integrating all levels of polyfunctionality in accordance with the Polyfunctionality Index. Conclusions Our study presents a generalizable methodology to objectively evaluate the impact of polyfunctionality on T cell efficacy. We show that T cell polyfunctionality

  7. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

    PubMed Central

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-01-01

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

  8. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    PubMed

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  9. Undecylprodigiosin selectively induces apoptosis in human breast carcinoma cells independent of p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, T.-F.; Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan; Department of Medical Technology, Central Taiwan University of Science and Technology, Taichung 40605, Taiwan

    2007-12-15

    Undecylprodigiosin (UP) is a bacterial bioactive metabolite produced by Streptomyces and Serratia. In this study, we explored the anticancer effect of UP. Human breast carcinoma cell lines BT-20, MCF-7, MDA-MB-231 and T47D and one nonmalignant human breast epithelial cell line, MCF-10A, were tested in this study. We found that UP exerted a potent cytotoxicity against all breast carcinoma cell lines in a dose- and time-dependent manner. In contrast, UP showed limited toxicity to MCF-10A cells, indicating UP's cytotoxic effect is selective for malignant cells. UP's cytotoxic effect was due to apoptosis, as confirmed by positive TUNEL signals, annexin V-binding, caspasemore » 9 activation and PARP cleavage. Notably, UP-induced apoptosis was blocked by the pan-caspase inhibitor z-VAD.fmk, further indicating the involvement of caspase activity. Moreover, UP caused a marked decrease of the levels of antiapoptotic BCL-X{sub L}, Survivin and XIAP while enhancing the levels of proapoptotic BIK, BIM, MCL-1S and NOXA, consequently favoring induction of apoptosis. Additionally, we found that cells with functional p53 (MCF-7, T47D) or mutant p53 (BT-20, MDA-MB-231) were both susceptible to UP's cytotoxicity. Importantly, UP was able to induce apoptosis in MCF-7 cells with p53 knockdown by RNA interference, confirming the dispensability of p53 in UP-induced apoptosis. Overall, our results establish that UP induces p53-independent apoptosis in breast carcinoma cells with no marked toxicity to nonmalignant cells, raising the possibility of its use as a new chemotherapeutic drug for breast cancer irrespective of p53 status.« less

  10. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

  11. Brain Ischemia Induces Diversified Neuroantigen-Specific T-Cell Responses That Exacerbate Brain Injury.

    PubMed

    Jin, Wei-Na; Gonzales, Rayna; Feng, Yan; Wood, Kristofer; Chai, Zhi; Dong, Jing-Fei; La Cava, Antonio; Shi, Fu-Dong; Liu, Qiang

    2018-06-01

    Autoimmune responses can occur when antigens from the central nervous system are presented to lymphocytes in the periphery or central nervous system in several neurological diseases. However, whether autoimmune responses emerge after brain ischemia and their impact on clinical outcomes remains controversial. We hypothesized that brain ischemia facilitates the genesis of autoimmunity and aggravates ischemic brain injury. Using a mouse strain that harbors a transgenic T-cell receptor to a central nervous system antigen, MOG 35-55 (myelin oligodendrocyte glycoprotein) epitope (2D2), we determined the anatomic location and involvement of antigen-presenting cells in the development of T-cell reactivity after brain ischemia and how T-cell reactivity impacts stroke outcome. Transient middle cerebral artery occlusion and photothrombotic stroke models were used in this study. We also quantified the presence and status of T cells from brain slices of ischemic patients. By coupling transfer of labeled MOG 35-55 -specific (2D2) T cells with tetramer tracking, we show an expansion in reactivity of 2D2 T cells to MOG 91-108 and MOG 103-125 in transient middle cerebral artery occlusion and photothrombotic stroke models. This reactivity and T-cell activation first occur locally in the brain after ischemia. Also, microglia act as antigen-presenting cells that effectively present MOG antigens, and depletion of microglia ablates expansion of 2D2 reactive T cells. Notably, the adoptive transfer of neuroantigen-experienced 2D2 T cells exacerbates Th1/Th17 responses and brain injury. Finally, T-cell activation and MOG-specific T cells are present in the brain of patients with ischemic stroke. Our findings suggest that brain ischemia activates and diversifies T-cell responses locally, which exacerbates ischemic brain injury. © 2018 The Authors.

  12. The Stress-responsive Gene ATF3 Mediates Dichotomous UV Responses by Regulating the Tip60 and p53 Proteins*

    PubMed Central

    Cui, Hongmei; Li, Xingyao; Han, Chunhua; Wang, Qi-En; Wang, Hongbo; Ding, Han-Fei; Zhang, Junran; Yan, Chunhong

    2016-01-01

    The response to UV irradiation is important for a cell to maintain its genetic integrity when challenged by environmental genotoxins. An immediate early response to UV irradiation is the rapid induction of activating transcription factor 3 (ATF3) expression. Although emerging evidence has linked ATF3 to stress pathways regulated by the tumor suppressor p53 and the histone acetyltransferase Tip60, the role of ATF3 in the UV response remains largely unclear. Here, we report that ATF3 mediated dichotomous UV responses. Although UV irradiation enhanced the binding of ATF3 to Tip60, knockdown of ATF3 expression decreased Tip60 stability, thereby impairing Tip60 induction by UV irradiation. In line with the role of Tip60 in mediating UV-induced apoptosis, ATF3 promoted the death of p53-defective cells in response to UV irradiation. However, ATF3 could also activate p53 and promote p53-mediated DNA repair, mainly through altering histone modifications that could facilitate recruitment of DNA repair proteins (such as DDB2) to damaged DNA sites. As a result, ATF3 rather protected the p53 wild-type cells from UV-induced apoptosis. Our results thus indicate that ATF3 regulates cell fates upon UV irradiation in a p53-dependent manner. PMID:26994140

  13. The ubiquitin ligase LIN41/TRIM71 targets p53 to antagonize cell death and differentiation pathways during stem cell differentiation

    PubMed Central

    Nguyen, Duong Thi Thuy; Richter, Daniel; Michel, Geert; Mitschka, Sibylle; Kolanus, Waldemar; Cuevas, Elisa; Gregory Wulczyn, F

    2017-01-01

    Rapidity and specificity are characteristic features of proteolysis mediated by the ubiquitin-proteasome system. Therefore, the UPS is ideally suited for the remodeling of the embryonic stem cell proteome during the transition from pluripotent to differentiated states and its inverse, the generation of inducible pluripotent stem cells. The Trim-NHL family member LIN41 is among the first E3 ubiquitin ligases to be linked to stem cell pluripotency and reprogramming. Initially discovered in C. elegans as a downstream target of the let-7 miRNA, LIN41 is now recognized as a critical regulator of stem cell fates as well as the timing of neurogenesis. Despite being indispensable for embryonic development and neural tube closure in mice, the underlying mechanisms for LIN41 function in these processes are poorly understood. To better understand the specific contributions of the E3 ligase activity for the stem cell functions of LIN41, we characterized global changes in ubiquitin or ubiquitin-like modifications using Lin41-inducible mouse embryonic stem cells. The tumor suppressor protein p53 was among the five most strongly affected proteins in cells undergoing neural differentiation in response to LIN41 induction. We show that LIN41 interacts with p53, controls its abundance by ubiquitination and antagonizes p53-dependent pro-apoptotic and pro-differentiation responses. In vivo, the lack of LIN41 is associated with upregulation of Grhl3 and widespread caspase-3 activation, two downstream effectors of p53 with essential roles in neural tube closure. As Lin41-deficient mice display neural tube closure defects, we conclude that LIN41 is critical for the regulation of p53 functions in cell fate specification and survival during early brain development. PMID:28430184

  14. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together

  15. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    PubMed

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  16. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

  17. Dendritic Cells Program Non-Immunogenic Prostate-Specific T Cell Responses Beginning at Early Stages of Prostate Tumorigenesis

    PubMed Central

    Mihalyo, Marianne A.; Hagymasi, Adam T.; Slaiby, Aaron M.; Nevius, Erin E.; Adler, Adam J.

    2010-01-01

    BACKGROUND Prostate cancer promotes the development of T cell tolerance towards prostatic antigens, potentially limiting the efficacy of prostate cancer vaccines targeting these antigens. Here, we sought to determine the stage of disease progression when T cell tolerance develops, as well as the role of steady state dendritic cells (DC) and CD4+CD25+ T regulatory cells (Tregs) in programming tolerance. METHODS The response of naïve HA-specific CD4+ T cells were analyzed following adoptive transfer into Pro-HA × TRAMP transgenic mice harboring variably-staged HA-expressing prostate tumors on two genetic backgrounds that display different patterns and kinetics of tumorigenesis. The role of DC and Tregs in programming HA-specific CD4 cell responses were assessed via depletion. RESULTS HA-specific CD4 cells underwent non-immunogenic responses at all stages of tumorigenesis in both genetic backgrounds. These responses were completely dependent on DC, but not appreciably influenced by Tregs. CONCLUSIONS These results suggest that tolerogenicity is an early and general property of prostate tumors. PMID:17221844

  18. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  19. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    PubMed Central

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  20. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

  1. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

    PubMed Central

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  2. p53 Is a Host Cell Regulator during Herpes Simplex Encephalitis.

    PubMed

    Maruzuru, Yuhei; Koyanagi, Naoto; Takemura, Naoki; Uematsu, Satoshi; Matsubara, Daisuke; Suzuki, Yutaka; Arii, Jun; Kato, Akihisa; Kawaguchi, Yasushi

    2016-08-01

    p53 is a critical host cell factor in the cellular response to a broad range of stress factors. We recently reported that p53 is required for efficient herpes simplex virus 1 (HSV-1) replication in cell culture. However, a defined role for p53 in HSV-1 replication and pathogenesis in vivo remains elusive. In this study, we examined the effects of p53 on HSV-1 infection in vivo using p53-deficient mice. Following intracranial inoculation, p53 knockout reduced viral replication in the brains of mice and led to significantly reduced rates of mortality due to herpes simplex encephalitis. These results suggest that p53 is an important host cell regulator of HSV-1 replication and pathogenesis in the central nervous system (CNS). HSV-1 causes sporadic cases of encephalitis, which, even with antiviral therapy, can result in severe neurological defects and even death. Many host cell factors involved in the regulation of CNS HSV-1 infection have been investigated using genetically modified mice. However, most of these factors are immunological regulators and act via immunological pathways in order to restrict CNS HSV-1 infection. They therefore provide limited information on intrinsic host cell regulators that may be involved in the facilitation of CNS HSV-1 infection. Here we demonstrate that a host cell protein, p53, which has generally been considered a host cell restriction factor for various viral infections, is required for efficient HSV-1 replication and pathogenesis in the CNS of mice. This is the first report showing that p53 positively regulates viral replication and pathogenesis in vivo and provides insights into its molecular mechanism, which may suggest novel clinical treatment options for herpes simplex encephalitis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

    PubMed Central

    Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

    2014-01-01

    p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

  4. An adaptive molecular timer in p53-meidated cell fate decision

    NASA Astrophysics Data System (ADS)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  5. Application of the pMHC Array to Characterise Tumour Antigen Specific T Cell Populations in Leukaemia Patients at Disease Diagnosis.

    PubMed

    Brooks, Suzanne E; Bonney, Stephanie A; Lee, Cindy; Publicover, Amy; Khan, Ghazala; Smits, Evelien L; Sigurdardottir, Dagmar; Arno, Matthew; Li, Demin; Mills, Ken I; Pulford, Karen; Banham, Alison H; van Tendeloo, Viggo; Mufti, Ghulam J; Rammensee, Hans-Georg; Elliott, Tim J; Orchard, Kim H; Guinn, Barbara-ann

    2015-01-01

    Immunotherapy treatments for cancer are becoming increasingly successful, however to further improve our understanding of the T-cell recognition involved in effective responses and to encourage moves towards the development of personalised treatments for leukaemia immunotherapy, precise antigenic targets in individual patients have been identified. Cellular arrays using peptide-MHC (pMHC) tetramers allow the simultaneous detection of different antigen specific T-cell populations naturally circulating in patients and normal donors. We have developed the pMHC array to detect CD8+ T-cell populations in leukaemia patients that recognise epitopes within viral antigens (cytomegalovirus (CMV) and influenza (Flu)) and leukaemia antigens (including Per Arnt Sim domain 1 (PASD1), MelanA, Wilms' Tumour (WT1) and tyrosinase). We show that the pMHC array is at least as sensitive as flow cytometry and has the potential to rapidly identify more than 40 specific T-cell populations in a small sample of T-cells (0.8-1.4 x 10(6)). Fourteen of the twenty-six acute myeloid leukaemia (AML) patients analysed had T cells that recognised tumour antigen epitopes, and eight of these recognised PASD1 epitopes. Other tumour epitopes recognised were MelanA (n = 3), tyrosinase (n = 3) and WT1(126-134) (n = 1). One of the seven acute lymphocytic leukaemia (ALL) patients analysed had T cells that recognised the MUC1(950-958) epitope. In the future the pMHC array may be used provide point of care T-cell analyses, predict patient response to conventional therapy and direct personalised immunotherapy for patients.

  6. Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

    PubMed

    Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

    1999-06-01

    The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

  7. Genistein abrogates G2 arrest induced by curcumin in p53 deficient T47D cells

    PubMed Central

    2012-01-01

    Background The high cost and low level of cancer survival urge the finding of new drugs having better mechanisms. There is a high trend of patients to be “back to nature” and use natural products as an alternative way to cure cancer. The fact is that some of available anticancer drugs are originated from plants, such as taxane, vincristine, vinblastine, pacitaxel. Curcumin (diferuloylmethane), a dietary pigment present in Curcuma longa rizhome is reported to induce cell cycle arrest in some cell lines. Other study reported that genistein isolated from Glycine max seed inhibited phosphorylation of cdk1, gene involved during G2/M transition and thus could function as G2 checkpoint abrogator. The inhibition of cdk1 phosphorylation is one of alternative strategy which could selectively kill cancer cells and potentially be combined with DNA damaging agent such as curcumin. Methods T47D cell line was treated with different concentrations of curcumin and genistein, alone or in combination; added together or with interval time. Flow Cytometry and MTT assay were used to evaluate cell cycle distribution and viability, respectively. The presence of apoptotic cells was determined using acridine orange-ethidium bromide staining. Results In this study curcumin induced G2 arrest on p53 deficient T47D cells at the concentration of 10 μM. Increasing concentration up to 30 μM increased the number of cell death. Whilst genistein alone at low concentration (≤10 μM) induced cell proliferation, addition of genistein (20 μM) 16 h after curcumin resulted in more cell death (89%), 34% higher than that administered at the same time (56%). The combination treatment resulted in apoptotic cell death. Combining curcumin with high dose of genistein (50 μM) induced necrotic cells. Conclusions Genistein increased the death of curcumin treated T47D cells. Appropriate timing of administration and concentration of genistein determine the outcome of treatment and this method

  8. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  9. The RNA surveillance protein SMG1 activates p53 in response to DNA double-strand breaks but not exogenously oxidized mRNA

    PubMed Central

    Gewandter, Jennifer S; Bambara, Robert A

    2011-01-01

    DNA damage, stalled replication forks, errors in mRNA splicing and availability of nutrients activate specific phosphatidylinositiol-3-kinase-like kinases (PIKKs) that in turn phosphorylate downstream targets such as p53 on serine 15. While the PIKK proteins ATM and ATR respond to specific DNA lesions, SMG1 responds to errors in mRNA splicing and when cells are exposed to genotoxic stress. Yet, whether genotoxic stress activates SMG1 through specific types of DNA lesions or RNA damage remains poorly understood. Here, we demonstrate that siRNA oligonucleotides targeting the mRNA surveillance proteins SMG1, Upf1, Upf2 or the PIKK protein ATM attenuated p53 (ser15) phosphorylation in cells damaged by high oxygen (hyperoxia), a model of persistent oxidative stress that damages nucleotides. In contrast, loss of SMG1 or ATM, but not Upf1 or Upf2 reduced p53 (ser15) phosphorylation in response to DNA double strand breaks produced by expression of the endonuclease I-PpoI. To determine whether SMG1-dependent activation of p53 was in response to oxidative mRNA damage, mRNA encoding green fluorescence protein (GFP) transcribed in vitro was oxidized by Fenton chemistry and transfected into cells. Although oxidation of GFP mRNA resulted in dose-dependent fragmentation of the mRNA and reduced expression of GFP, it did not stimulate p53 or the p53-target gene p21. These findings establish SMG1 activates p53 in response to DNA double strand breaks independent of the RNA surveillance proteins Upf1 or Upf2; however, these proteins can stimulate p53 in response to oxidative stress but not necessarily oxidized RNA. PMID:21701263

  10. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

    PubMed

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-04-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.

  11. P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

    PubMed

    Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

    2008-07-01

    To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

  12. Neutral Polymer Micelle Carriers with pH-Responsive, Endosome-Releasing Activity Modulate Antigen Trafficking to Enhance CD8 T-Cell Responses

    PubMed Central

    Keller, Salka; Wilson, John T; Patilea, Gabriela I; Kern, Hanna B; Convertine, Anthony J; Stayton, Patrick S

    2014-01-01

    Synthetic subunit vaccines need to induce CD8+ cytotoxic T-cell (CTL) responses for effective vaccination against intracellular pathogens. Most subunit vaccines primarily generate humoral immune responses, with a weaker than desired CD8+ cytotoxic T-cell response. Here, a neutral, pH-responsive polymer micelle carrier that alters intracellular antigen trafficking was shown to enhance CD8+ T-cell responses with a correlated increase in cytosolic delivery and a decrease in exocytosis. Polymer diblock carriers consisted of a N-(2-hydroxypropyl) methacrylamide corona block with pendant pyridyl disulfide groups for reversible conjugation of thiolated ovalbumin, and a tercopolymer ampholytic core-forming block composed of propylacrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The diblock copolymers self-assembled into 25–30 nm diameter micellar nanoparticles. Conjugation of ovalbumin to the micelles significantly enhanced antigen cross-presentation in vitro relative to free ovalbumin, an unconjugated physical mixture of ovalbumin and polymer, and a non pH-responsive micelle-ovalbumin control. Mechanistic studies in a murine dendritic cell line (DC2.4) demonstrated micelle-mediated enhancements in intracellular antigen retention and cytosolic antigen accumulation. Approximately 90% of initially internalized ovalbumin-conjugated micelles were retained in cells after 1.5 h, compared to only ~40% for controls. Furthermore, cells dosed with conjugates displayed 67-fold higher cytosolic antigen levels relative to soluble ovalbumin 4 h post uptake. Subcutaneous immunization of mice with ovalbumin-polymer conjugates significantly enhanced antigen-specific CD8+ T cell responses (0.4 % IFN-γ+ of CD8+) compared to immunization with soluble protein, ovalbumin and polymer mixture, and the control micelle without endosome-releasing activity. Additionally, pH-responsive carrier facilitated antigen delivery to antigen presenting cells in the

  13. Neutral polymer micelle carriers with pH-responsive, endosome-releasing activity modulate antigen trafficking to enhance CD8(+) T cell responses.

    PubMed

    Keller, Salka; Wilson, John T; Patilea, Gabriela I; Kern, Hanna B; Convertine, Anthony J; Stayton, Patrick S

    2014-10-10

    Synthetic subunit vaccines need to induce CD8(+) cytotoxic T cell (CTL) responses for effective vaccination against intracellular pathogens. Most subunit vaccines primarily generate humoral immune responses, with a weaker than desired CD8(+) cytotoxic T cell response. Here, a neutral, pH-responsive polymer micelle carrier that alters intracellular antigen trafficking was shown to enhance CD8(+) T cell responses with a correlated increase in cytosolic delivery and a decrease in exocytosis. Polymer diblock carriers consisted of a N-(2-hydroxypropyl) methacrylamide corona block with pendent pyridyl disulfide groups for reversible conjugation of thiolated ovalbumin, and a tercopolymer ampholytic core-forming block composed of propylacrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The diblock copolymers self-assembled into 25-30nm diameter micellar nanoparticles. Conjugation of ovalbumin to the micelles significantly enhanced antigen cross-presentation in vitro relative to free ovalbumin, an unconjugated physical mixture of ovalbumin and polymer, and a non-pH-responsive micelle-ovalbumin control. Mechanistic studies in a murine dendritic cell line (DC 2.4) demonstrated micelle-mediated enhancements in intracellular antigen retention and cytosolic antigen accumulation. Approximately 90% of initially internalized ovalbumin-conjugated micelles were retained in cells after 1.5h, compared to only ~40% for controls. Furthermore, cells dosed with conjugates displayed 67-fold higher cytosolic antigen levels relative to soluble ovalbumin 4h post uptake. Subcutaneous immunization of mice with ovalbumin-polymer conjugates significantly enhanced antigen-specific CD8(+) T cell responses (0.4% IFN-γ(+) of CD8(+)) compared to immunization with soluble protein, ovalbumin and polymer mixture, and the control micelle without endosome-releasing activity. Additionally, pH-responsive carrier facilitated antigen delivery to antigen presenting cells

  14. p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

    2013-06-15

    Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are

  15. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    PubMed

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  16. Clonal analysis of T-cell responses to herpes simplex virus: isolation, characterization and antiviral properties of an antigen-specific helper T-cell clone.

    PubMed Central

    Leung, K N; Nash, A A; Sia, D Y; Wildy, P

    1984-01-01

    A herpes simplex virus (HSV)-specific long-term T-cell clone has been established from the draining lymph node cells of BALB/c mice; the cells required repeated in vitro restimulation with UV-irradiated virus. The established T-cell clone expresses the Thy-1 and Lyt-1+2,3- surface antigens. For optimal proliferation of the cloned cells, both the presence of specific antigen and an exogenous source of T-cell growth factor are required. The proliferative response of the cloned T cells was found to be virus-specific but it did not distinguish between HSV-1 and HSV-2. Adoptive cell transfer of the cloned T cells helped primed B cells to produce anti-herpes antibodies: the response was antigen-specific and cell dose-dependent. The clone failed to produce a significant DTH reaction in vivo, but did produce high levels of macrophage-activating factor. Furthermore, the T-cell clone could protect from HSV infection, as measured by a reduction in local virus growth, and by enhanced survival following the challenge of mice with a lethal dose of virus. The mechanism(s) whereby this clone protects in vivo is discussed. PMID:6209206

  17. Clonal analysis of T-cell responses to herpes simplex virus: isolation, characterization and antiviral properties of an antigen-specific helper T-cell clone.

    PubMed

    Leung, K N; Nash, A A; Sia, D Y; Wildy, P

    1984-12-01

    A herpes simplex virus (HSV)-specific long-term T-cell clone has been established from the draining lymph node cells of BALB/c mice; the cells required repeated in vitro restimulation with UV-irradiated virus. The established T-cell clone expresses the Thy-1 and Lyt-1+2,3- surface antigens. For optimal proliferation of the cloned cells, both the presence of specific antigen and an exogenous source of T-cell growth factor are required. The proliferative response of the cloned T cells was found to be virus-specific but it did not distinguish between HSV-1 and HSV-2. Adoptive cell transfer of the cloned T cells helped primed B cells to produce anti-herpes antibodies: the response was antigen-specific and cell dose-dependent. The clone failed to produce a significant DTH reaction in vivo, but did produce high levels of macrophage-activating factor. Furthermore, the T-cell clone could protect from HSV infection, as measured by a reduction in local virus growth, and by enhanced survival following the challenge of mice with a lethal dose of virus. The mechanism(s) whereby this clone protects in vivo is discussed.

  18. Effects of Interleukin-12 and Interleukin-15 on Measles-Specific T-Cell Responses in Vaccinated Infants

    PubMed Central

    YASUKAWA, LINDA L.; ZHANG, CATHRYN Z.; WAKIM, RIMA HANNA; RINKI, MARY; DEHOVITZ, ROSS; ARVIN, ANN M.

    2008-01-01

    Abstract Understanding the infant host response to measles vaccination is important because of their increased mortality from measles and the need to provide effective protection during the first year of life. Measles-specific T- and B-cell responses are lower in infants after measles vaccination than in adults. To define potential mechanisms, we investigated age-related differences in measles-specific T-cell proliferation, CD40-L expression, and IFN-γ production after measles immunization, and the effects of rhIL-12 and rhIL-15 on these responses. Measles-specific T-cell proliferation and mean IFN-γ release from infant PBMCs were significantly lower when compared with responses of vaccinated children and adults. Infant responses increased to ranges observed in children and adults when both rhIL-12 and rhIL-15 were added to PBMC cultures. Furthermore, a significant rise in T-cell proliferation and IFN-γ release was observed when infant PBMCs were stimulated with measles antigen in the presence of rhIL-12 and rhIL-15 compared to measles antigen alone. CD40-L expression by infant and adult T cells stimulated with measles antigen was comparable, but fewer infant CD40-L+ T cells expressed IFN-γ. These observations suggest that lower measles-specific T-cell immune responses elicited by measles vaccine in infants may be due to diminished levels of key cytokines. PMID:18419254

  19. Induction of myeloma-specific cytotoxic T lymphocytes responses by natural killer cells stimulated-dendritic cells in patients with multiple myeloma.

    PubMed

    Nguyen-Pham, Thanh-Nhan; Im, Chang-Min; Nguyen, Truc-Anh Thi; Lim, Mi-Seon; Hong, Cheol Yi; Kim, Mi-Hyun; Lee, Hyun Ju; Lee, Youn-Kyung; Cho, Duck; Ahn, Jae-Sook; Yang, Deok-Hwan; Kim, Yeo-Kyeoung; Chung, Ik-Joo; Kim, Hyeoung-Joon; Lee, Je-Jung

    2011-09-01

    The interaction between dendritic cells (DCs) and natural killer (NK) cells plays a key role in inducing DC maturation for subsequent T-cell priming. We investigated to generate potent DCs by stimulated with NK cells to induce myeloma-specific cytotoxic T lymphocytes (CTLs). NK cells-stimulated-DCs exhibited high expression of costimulatory molecules and high production of IL-12p70. These DCs induce high potency of Th1 polarization and exhibit a high ability to generate myeloma-specific CTLs responses. These results suggest that functionally potent DCs can be generated by stimulation with NK cells and may provide an effective source of DC-based immunotherapy in multiple myeloma. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    PubMed

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC

  1. Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

    PubMed

    Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W

    2012-01-01

    Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

  2. Dynamics of Tissue-Specific CD8+ T Cell Responses during West Nile Virus Infection.

    PubMed

    Aguilar-Valenzuela, Renan; Netland, Jason; Seo, Young-Jin; Bevan, Michael J; Grakoui, Arash; Suthar, Mehul S

    2018-05-15

    The mouse model of West Nile virus (WNV), which is a leading cause of mosquito-borne encephalitis worldwide, has provided fundamental insights into the host and viral factors that regulate viral pathogenesis and infection outcome. In particular, CD8 + T cells are critical for controlling WNV replication and promoting protection against infection. Here, we present the characterization of a T cell receptor (TCR)-transgenic mouse with specificity for the immunodominant epitope in the WNV NS4B protein (here referred to as transgenic WNV-I mice). Using an adoptive-transfer model, we found that WNV-I CD8 + T cells behave similarly to endogenous CD8 + T cell responses, with an expansion phase in the periphery beginning around day 7 postinfection (p.i.) followed by a contraction phase through day 15 p.i. Through the use of in vivo intravascular immune cell staining, we determined the kinetics, expansion, and differentiation into effector and memory subsets of WNV-I CD8 + T cells within the spleen and brain. We found that red-pulp WNV-I CD8 + T cells were more effector-like than white-pulp WNV-I CD8 + T cells, which displayed increased differentiation into memory precursor cells. Within the central nervous system (CNS), we found that WNV-I CD8 + T cells were polyfunctional (gamma interferon [IFN-γ] and tumor necrosis factor alpha [TNF-α]), displayed tissue-resident characteristics (CD69 + and CD103 + ), persisted in the brain through day 15 p.i., and reduced the viral burden within the brain. The use of these TCR-transgenic WNV-I mice provides a new resource to dissect the immunological mechanisms of CD8 + T cell-mediated protection during WNV infection. IMPORTANCE West Nile Virus (WNV) is the leading cause of mosquito-borne encephalitis worldwide. There are currently no approved therapeutics or vaccines for use in humans to treat or prevent WNV infection. CD8 + T cells are critical for controlling WNV replication and protecting against infection. Here, we present a

  3. Deficient EBV-specific B- and T-cell response in patients with chronic fatigue syndrome.

    PubMed

    Loebel, Madlen; Strohschein, Kristin; Giannini, Carolin; Koelsch, Uwe; Bauer, Sandra; Doebis, Cornelia; Thomas, Sybill; Unterwalder, Nadine; von Baehr, Volker; Reinke, Petra; Knops, Michael; Hanitsch, Leif G; Meisel, Christian; Volk, Hans-Dieter; Scheibenbogen, Carmen

    2014-01-01

    Epstein-Barr virus (EBV) has long been discussed as a possible cause or trigger of Chronic Fatigue Syndrome (CFS). In a subset of patients the disease starts with infectious mononucleosis and both enhanced and diminished EBV-specific antibody titers have been reported. In this study, we comprehensively analyzed the EBV-specific memory B- and T-cell response in patients with CFS. While we observed no difference in viral capsid antigen (VCA)-IgG antibodies, EBV nuclear antigen (EBNA)-IgG titers were low or absent in 10% of CFS patients. Remarkably, when analyzing the EBV-specific memory B-cell reservoir in vitro a diminished or absent number of EBNA-1- and VCA-antibody secreting cells was found in up to 76% of patients. Moreover, the ex vivo EBV-induced secretion of TNF-α and IFN-γ was significantly lower in patients. Multicolor flow cytometry revealed that the frequencies of EBNA-1-specific triple TNF-α/IFN-γ/IL-2 producing CD4(+) and CD8(+) T-cell subsets were significantly diminished whereas no difference could be detected for HCMV-specific T-cell responses. When comparing EBV load in blood immune cells, we found more frequently EBER-DNA but not BZLF-1 RNA in CFS patients compared to healthy controls suggesting more frequent latent replication. Taken together, our findings give evidence for a deficient EBV-specific B- and T-cell memory response in CFS patients and suggest an impaired ability to control early steps of EBV reactivation. In addition the diminished EBV response might be suitable to develop diagnostic marker in CFS.

  4. Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

    PubMed Central

    Murakami, Yohei; Takada, Shoji

    2012-01-01

    Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

  5. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    PubMed

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  6. Prophylactic and therapeutic vaccination with carrier-bound Bet v 1 peptides lacking allergen-specific T cell epitopes reduces Bet v 1-specific T cell responses via blocking antibodies in a murine model for birch pollen allergy.

    PubMed

    Linhart, B; Narayanan, M; Focke-Tejkl, M; Wrba, F; Vrtala, S; Valenta, R

    2014-02-01

    Vaccines consisting of allergen-derived peptides lacking IgE reactivity and allergen-specific T cell epitopes bound to allergen-unrelated carrier molecules have been suggested as candidates for allergen-specific immunotherapy. To study whether prophylactic and therapeutic vaccination with carrier-bound peptides from the major birch pollen allergen Bet v 1 lacking allergen-specific T cell epitopes has influence on Bet v 1-specific T cell responses. Three Bet v 1-derived peptides, devoid of Bet v 1-specific T cell epitopes, were coupled to KLH and adsorbed to aluminium hydroxide to obtain a Bet v 1-specific allergy vaccine. Groups of BALB/c mice were immunized with the peptide vaccine before or after sensitization to Bet v 1. Bet v 1- and peptide-specific antibody responses were analysed by ELISA. T cell and cytokine responses to Bet v 1, KLH, and the peptides were studied in proliferation assays. The effects of peptide-specific and allergen-specific antibodies on T cell responses and allergic lung inflammation were studied using specific antibodies. Prophylactic and therapeutic vaccination with carrier-bound Bet v 1 peptides induced a Bet v 1-specific IgG antibody response without priming/boosting of Bet v 1-specific T cells. Prophylactic and therapeutic vaccination of mice with the peptide vaccine induced Bet v 1-specific antibodies which suppressed Bet v 1-specific T cell responses and allergic lung inflammation. Vaccination with carrier-bound allergen-derived peptides lacking allergen-specific T cell epitopes induces allergen-specific IgG antibodies which suppress allergen-specific T cell responses and allergic lung inflammation. © 2013 John Wiley & Sons Ltd.

  7. Regulatory T-cell activity but not conventional HIV-specific T-cell responses are associated with protection from HIV-1 infection

    PubMed Central

    Pattacini, Laura; Baeten, Jared M.; Thomas, Katherine K.; Fluharty, Tayler R.; Murnane, Pamela M.; Donnell, Deborah; Bukusi, Elizabeth; Ronald, Allan; Mugo, Nelly; Lingappa, Jairam R.; Celum, Connie; McElrath, M. Juliana; Lund, Jennifer M.

    2015-01-01

    Objective Two distinct hypotheses have been proposed for T-cell involvement in protection from HIV-1 acquisition. First, HIV-1-specific memory T-cell responses generated upon HIV-1 exposure could mount an efficient response to HIV-1 and inhibit the establishment of an infection. Second, a lower level of immune activation could reduce the numbers of activated, HIV-1-susceptible CD4+ T-cells, thereby diminishing the likelihood of infection. Methods To test these hypotheses, we conducted a prospective study among high-risk heterosexual men and women, and tested peripheral blood samples from individuals who subsequently acquired HIV-1 during follow-up (cases) and from a subset of those who remained HIV-1 uninfected (controls). Results We found no difference in HIV-1-specific immune responses between cases and controls, but Treg frequency was higher in controls as compared to cases and was negatively associated with frequency of effector memory CD4+ T-cells. Conclusions Our findings support the hypothesis that low immune activation assists in protection from HIV-1 infection. PMID:26656786

  8. Wt-p53 action in human leukaemia cell lines corresponding to different stages of differentiation.

    PubMed

    Rizzo, M G; Zepparoni, A; Cristofanelli, B; Scardigli, R; Crescenzi, M; Blandino, G; Giuliacci, S; Ferrari, S; Soddu, S; Sacchi, A

    1998-05-01

    Recent studies support the potential application of the wt-p53 gene in cancer therapy. Expression of exogenous wt-p53 suppresses a variety of leukaemia phenotypes by acting on cell survival, proliferation and/or differentiation. As for tumour gene therapy, the final fate of the neoplastic cells is one of the most relevant points. We examined the effects of exogenous wt-p53 gene expression in several leukaemia cell lines to identify p53-responsive leukaemia. The temperature-sensitive p53Val135 mutant or the human wt-p53 cDNA was transduced in leukaemia cell lines representative of different acute leukaemia FAB subtypes, including M1 (KG1), M2 (HL-60), M3 (NB4), M5 (U937) and M6 (HEL 92.1.7), as well as blast crisis of chronic myelogenous leukaemia (BC-CML: K562, BV173) showing diverse differentiation features. By morphological, molecular and biochemical analyses, we have shown that exogenous wt-p53 gene expression induces apoptosis only in cells corresponding to M1, M2 and M3 of the FAB classification and in BC-CML showing morphological and cytochemical features of undifferentiated blast cells. In contrast, it promotes differentiation in the others. Interestingly, cell responsiveness was independent of the vector used and the status of the endogenous p53 gene.

  9. Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

    PubMed

    Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

    2016-01-01

    Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

  10. Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

    PubMed

    Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

    2016-01-01

    Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

  11. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  12. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  13. Phytochemical regulation of the tumor suppressive microRNA, miR-34a, by p53-dependent and independent responses in human breast cancer cells

    PubMed Central

    Hargraves, Kris G.; He, Lin; Firestone, Gary L.

    2016-01-01

    The tumor suppressive microRNA miR-34a is transcriptionally regulated by p53 and shown to inhibit breast cancer cell proliferation as well as being a marker of increased disease free survival. Indole-3-carbinol (I3C) derived from cruciferous vegetables, artemisinin, extracted from the sweet wormwood plant, and artesunate, a semi-synthetic derivative of artemisinin, are phytochemicals with anti-tumorigenic properties however, little is known about the role of microRNAs in their mechanism of action. Human breast cancer cells expressing wild-type (MCF-7) or mutant p53 (T47D) were treated with a concentration range and time course of each phytochemical under conditions of cell cycle arrest as detected by flow cytometry to examine the potential connection between miR-34a expression and their anti-proliferative responses. Real-time PCR and western blot analysis of extracted RNA and total protein revealed artemsinin and artesunate increased miR-34a expression in a dose-dependent manner correlating with down-regulation of the miR-34a target gene, CDK4. I3C stimulation of miR-34a expression required functional p53, whereas, both artemisinin and artesunate up-regulated miR-34a expression regardless of p53 mutational status or in the presence of dominant negative p53. Phytochemical treatments inhibited the luciferase activity of a construct containing the wild-type 3′UTR of CDK4, but not those with a mutated miR-34a binding site, whereas, transfection of miR-34a inhibitors ablated the phytochemical mediated down-regulation of CDK4 and induction of cell cycle arrest. Our results suggest that miR-34a is an essential component of the anti-proliferative activities of I3C, artemisinin and artesunate and demonstrate that both wild-type p53 dependent and independent pathways are responsible for miR-34a induction. PMID:25789847

  14. Heterogeneity of T Cell Responses to Pandemic pH1N1 Monovalent Vaccine in HIV-Infected Pregnant Women.

    PubMed

    Weinberg, Adriana; Muresan, Petronella; Richardson, Kelly; Fenton, Terence; Dominguez, Teresa; Bloom, Anthony; Watts, D Heather; Abzug, Mark J; Nachman, Sharon A; Levin, Myron J

    2015-11-01

    We investigated the Th1 protective and regulatory T and B cell (Treg and Breg) responses to pH1N1 monovalent influenza vaccine (IIV1) in HIV-infected pregnant women on combination antiretroviral therapy (cART). Peripheral blood mononuclear cells (PBMCs) from 52 study participants were cryopreserved before and after vaccination and analyzed by flow cytometry. pH1N1-specific Th1, Treg, and Breg responses were measured in PBMCs after in vitro stimulation with pH1N1 and control antigen. The cohort analysis did not detect changes in pH1N1-Th1, Treg, or Breg subsets postvaccination. However, individual analyses distinguished subjects who mounted vigorous Th1 responses postvaccination from others who did not. Postvaccination, high pH1N1-Th1 correlated with high pH1N1-Treg and Breg responses, suggesting that low influenza effector responses did not result from excessive vaccine-induced immune regulation. High postvaccination pH1N1-Th1 responses correlated with baseline high PHA- and pH1N1-IFN-γ ELISpot and circulating CD4(+)CD39(+)% and CD8(+)CD39(+)% Treg, with low CD8(+) cell numbers and CD19(+)FOXP3(+)% Breg, but not with CD4(+) cell numbers or HIV viral load. These data highlight the heterogeneity of T cell responses to vaccines in HIV-infected individuals on cART. Predictors of robust Th1 responses to IIV include CD8(+) cell numbers, T cell functionality, and circulating Breg and Treg.

  15. hCLCA2 is a p53-inducible inhibitor of breast cancer cell proliferation

    PubMed Central

    Walia, Vijay; Ding, Ming; Kumar, Sumit; Nie, Daotai; Premkumar, Louis; Elble, Randolph C.

    2009-01-01

    hCLCA2 is frequently downregulated in breast cancer and is a candidate tumor suppressor gene. We show here that the hCLCA2 gene is strongly induced by p53 in response to DNA damage. Adenoviral expression of p53 induces hCLCA2 in a variety of breast cell lines. Further, we find that p53 binds to consensus elements in the hCLCA2 promoter and mutation of these sites abolishes p53-responsiveness and induction by DNA damage. Adenoviral transduction of hCLCA2 into immortalized cells induces p53, CDK inhibitors p21 and p27, and cell cycle arrest by 24 hours, and caspase induction and apoptosis by 40 hours post-infection. Transduction of the malignant tumor cell line BT549 on the other hand does not induce p53, p21, or p27 but instead induces apoptosis directly and more rapidly. Knockout and knockdown studies indicate that growth inhibition and apoptosis are signaled via multiple pathways. Conversely, suppression of hCLCA2 by RNA interference enhances proliferation of MCF10A and reduces sensitivity to doxorubicin. Gene expression profiles indicate that hCLCA2 levels are strongly predictive of tumor cell sensitivity to doxorubicin and other chemotherapeutics. Because certain Cl- channels are proposed to promote apoptosis by reducing intracellular pH, we tested whether, and established that, hCLCA2 enhances Cl- current in breast cancer cells and reduces pH to ∼6.7. These results reveal hCLCA2 as a novel p53-inducible growth inhibitor, explain how its downregulation confers a survival advantage to tumor cells, and suggest both prognostic and therapeutic applications. PMID:19654313

  16. Zn(II)-curc targets p53 in thyroid cancer cells.

    PubMed

    Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

    2015-10-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

  17. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4⁺ and CD8⁺ T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.

    PubMed

    Fornara, Chiara; Furione, Milena; Arossa, Alessia; Gerna, Giuseppe; Lilleri, Daniele

    2016-07-01

    To discriminate between primary (PI) and remote (RI) human cytomegalovirus (HCMV) infection, several immunological parameters were monitored for a 2-year period in 53 pregnant women with PI, and 33 pregnant women experiencing HCMV PI at least 5 years prior. Cytokine (IFN-γ and IL-2) production by and phenotype (effector/memory CD45RA(+)) of HCMV-specific CD4(+) and CD8(+) T-cells as well as the lymphoproliferative responses (LPR) were evaluated, with special reference to the comparison between a group of women transmitting (T) and a group of non-transmitting (NT) the infection to fetus. While HCMV-specific CD4(+) T-cells reached at 90 days post-infection (p.i.) values comparable to RI, CD8(+) T-cells reached at 60 days p.i. levels significantly higher and persisting throughout the entire follow-up. Instead, IL-2 production and lymphoproliferative responses were lower in PI than RI for the entire follow-up period. Effector memory CD45RA(+) CD4(+) and CD8(+) HCMV-specific T-cells increased until 90 days p.i., reaching and maintaining levels higher than RI. The comparison between T and NT women showed that, at 30 days p.i., in NT women there was a significantly higher IL-2 production by HCMV-specific CD4(+) T-cells, and at 60 days p.i. a significantly higher frequency of both specific CD4(+) and CD8(+) CD45RA(+) T-cells. HCMV T-cell response appears to correlate with virus transmission to fetus and some parameters (CD4(+) lymphoproliferation, and frequency of HCMV-specific CD8(+) IL2(+) T-cells) may help in dating PI during pregnancy. © 2015 Wiley Periodicals, Inc.

  18. Effects of mutations within the SV40 large T antigen ATPase/p53 binding domain on viral replication and transformation.

    PubMed

    Peden, K W; Srinivasan, A; Vartikar, J V; Pipas, J M

    1998-01-01

    The simian virus 40 (SV40) large T antigen is a 708 amino-acid protein possessing multiple biochemical activities that play distinct roles in productive infection or virus-induced cell transformation. The carboxy-terminal portion of T antigen includes a domain that carries the nucleotide binding and ATPase activities of the protein, as well as sequences required for T antigen to associate with the cellular tumor suppressor p53. Consequently this domain functions both in viral DNA replication and cellular transformation. We have generated a collection of SV40 mutants with amino-acid deletions, insertions or substitutions in specific domains of the protein. Here we report the properties of nine mutants with single or multiple substitutions between amino acids 402 and 430, a region thought to be important for both the p53 binding and ATPase functions. The mutants were examined for the ability to produce infectious progeny virions, replicate viral DNA in vivo, perform in trans complementation tests, and transform established cell lines. Two of the mutants exhibited a wild-type phenotype in all these tests. The remaining seven mutants were defective for plaque formation and viral DNA replication, but in each case these defects could be complemented by a wild-type T antigen supplied in trans. One of these replication-defective mutants efficiently transformed the REF52 and C3H10T1/2 cell lines as assessed by the dense-focus assay. The remaining six mutants were defective for transforming REF52 cells and transformed the C3H10T1/2 line with a reduced efficiency. The ability of mutant T antigen to transform REF52 cells correlated with their ability to induce increased levels of p53.

  19. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    PubMed

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  20. [Interaction between p53 and MDM2 in human lung cancer cells].

    PubMed

    Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

    2014-01-01

    The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and

  1. Ex vivo detection of adenovirus specific CD4{sup +} T-cell responses to HLA-DR-epitopes of the Hexon protein show a contracted specificity of T{sub HELPER} cells following stem cell transplantation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Serangeli, Celine; Bicanic, Oliver; Scheible, Michael H.

    2010-02-20

    Human adenovirus (HAdV) is a cause of significant morbidity and mortality in immunocompromised patients, especially after stem cell transplantation (SCT). Viral clearance has been attributed to CD4{sup +} T-cell responses against the Hexon-protein, but the frequency of specific T{sub HELPER} cells is extremely low or not detectable ex vivo and preference for different CD4{sup +} T-cell epitopes is variable among individuals. We therefore analyzed 44 healthy donors and 6 SCT-recipients for Hexon-specific CD4{sup +}-responses ex vivo, to identify epitopes which would be broadly applicable. We selected 19 candidate epitopes with predicted restriction to HLA-DR1/DR3/DR4/DR7; 16 were located within the highlymore » conserved regions, indicating cross-reactivity of T cells among HAdV-subspecies. Ten epitopes induced CD4{sup +}-proliferation in >50% of individuals, confirmed by intracellular IFN-gamma detection. Three SCT recipients who recovered from an infection with HAdV displayed reactivity towards only a single hexon epitope, whereas healthy individuals were responsive to two to eight epitopes (median 3). The ex vivo detection of Hexon-specific CD4{sup +} T-cells, without any long-term culture in vitro, enables the detection and generation of HAdV-specific CD4{sup +} T cells for adoptive T-cell transfer against HAdV-infection post SCT.« less

  2. Regulation of autophagy by cytoplasmic p53

    PubMed Central

    Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2009-01-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

  3. Qualitative features of the HIV-specific CD8+ T-cell response associated with immunologic control.

    PubMed

    Hersperger, Adam R; Migueles, Stephen A; Betts, Michael R; Connors, Mark

    2011-05-01

    Over the past 2 years, a clearer picture has emerged regarding the properties of HIV-specific CD8+ T cells associated with immunologic control of HIV replication. These properties represent a potential mechanism by which rare patients might control HIV replication in the absence of antiretroviral therapy. This review addresses the background and recent findings that have lead to our current understanding of these mechanism(s). Patients with immunologic control of HIV are not distinguished by targeted specificities, or greater numbers or breadth of their HIV-specific CD8+ T-cell response. For this reason, recent work has focused greater attention on qualitative features of this response. The qualitative features most closely associated with immunologic control of HIV are related to the granule-exocytosis-mediated elimination of HIV-infected CD4 T cells. The ability of HIV-specific CD8+ T cells to increase their contents of proteins known to mediate cytotoxicity, such as granzyme B and perforin, appears to be a critical means by which HIV-specific cytotoxic capacity is regulated. Investigation from multiple groups has now focused upon HIV-specific CD8+ T-cell granule-exocytosis-mediated cytotoxicity as a correlate of immunologic control of HIV. In the near future, a more detailed understanding of the qualities associated with immunologic control may provide critical insights regarding the necessary features of a response that should be stimulated by immunotherapies or T-cell-based vaccines.

  4. Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

    PubMed

    Garner, Elizabeth; Raj, Kenneth

    2008-02-01

    There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

  5. The Control of the Specificity of CD4 T Cell Responses: Thresholds, Breakpoints, and Ceilings

    PubMed Central

    Sant, Andrea J.; Chaves, Francisco A.; Leddon, Scott A.; Tung, Jacqueline

    2013-01-01

    It has been known for over 25 years that CD4 T cell responses are restricted to a finite number of peptide epitopes within pathogens or protein vaccines. These selected peptide epitopes are termed “immunodominant.” Other peptides within the antigen that can bind to host MHC molecules and recruit CD4 T cells as single peptides are termed “cryptic” because they fail to induce responses when expressed in complex proteins or when in competition with other peptides during the immune response. In the last decade, our laboratory has evaluated the mechanisms that underlie the preferential specificity of CD4 T cells and have discovered that both intracellular events within antigen presenting cells, particular selective DM editing, and intercellular regulatory pathways, involving IFN-γ, indoleamine 2,3-dioxygenase, and regulatory T cells, play a role in selecting the final peptide specificity of CD4 T cells. In this review, we summarize our findings, discuss the implications of this work on responses to pathogens and vaccines and speculate on the logic of these regulatory events. PMID:24167504

  6. High-Affinity Rb Binding, p53 Inhibition, Subcellular Localization, and Transformation by Wild-Type or Tumor-Derived Shortened Merkel Cell Polyomavirus Large T Antigens

    PubMed Central

    Borchert, Sophie; Czech-Sioli, Manja; Neumann, Friederike; Schmidt, Claudia; Wimmer, Peter; Dobner, Thomas

    2014-01-01

    ABSTRACT Interference with tumor suppressor pathways by polyomavirus-encoded tumor antigens (T-Ags) can result in transformation. Consequently, it is thought that T-Ags encoded by Merkel cell polyomavirus (MCPyV), a virus integrated in ∼90% of all Merkel cell carcinoma (MCC) cases, are major contributors to tumorigenesis. The MCPyV large T-Ag (LT-Ag) has preserved the key functional domains present in all family members but has also acquired unique regions that flank the LxCxE motif. As these regions may mediate unique functions, or may modulate those shared with T-Ags of other polyomaviruses, functional studies of MCPyV T-Ags are required. Here, we have performed a comparative study of full-length or MCC-derived truncated LT-Ags with regard to their biochemical characteristics, their ability to bind to retinoblastoma (Rb) and p53 proteins, and their transforming potential. We provide evidence that full-length MCPyV LT-Ag may not directly bind to p53 but nevertheless can significantly reduce p53-dependent transcription in reporter assays. Although early region expression constructs harboring either full-length or MCC-derived truncated LT-Ag genes can transform primary baby rat kidney cells, truncated LT-Ags do not bind to p53 or reduce p53-dependent transcription. Interestingly, shortened LT-Ags exhibit a very high binding affinity for Rb, as shown by coimmunoprecipitation and in vitro binding studies. Additionally, we show that truncated MCPyV LT-Ag proteins are expressed at higher levels than those for the wild-type protein and are able to partially relocalize Rb to the cytoplasm, indicating that truncated LT proteins may have gained additional features that distinguish them from the full-length protein. IMPORTANCE MCPyV is one of the 12 known polyomaviruses that naturally infect humans. Among these, it is of particular interest since it is the only human polyomavirus known to be involved in tumorigenesis. MCPyV is thought to be causally linked to MCC, a rare

  7. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    PubMed

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  8. Chemoprophylaxis with sporozoite immunization in P. knowlesi rhesus monkeys confers protection and elicits sporozoite-specific memory T cells in the liver

    PubMed Central

    Spring, Michele D.; Yongvanitchit, Kosol; Kum-Arb, Utaiwan; Limsalakpetch, Amporn; Im-Erbsin, Rawiwan; Ubalee, Ratawan; Vanachayangkul, Pattaraporn; Remarque, Edmond J.; Angov, Evelina; Smith, Philip L.; Saunders, David L.

    2017-01-01

    Whole malaria sporozoite vaccine regimens are promising new strategies, and some candidates have demonstrated high rates of durable clinical protection associated with memory T cell responses. Little is known about the anatomical distribution of memory T cells following whole sporozoite vaccines, and immunization of nonhuman primates can be used as a relevant model for humans. We conducted a chemoprophylaxis with sporozoite (CPS) immunization in P. knowlesi rhesus monkeys and challenged via mosquito bites. Half of CPS immunized animals developed complete protection, with a marked delay in parasitemia demonstrated in the other half. Antibody responses to whole sporozoites, CSP, and AMA1, but not CelTOS were detected. Peripheral blood T cell responses to whole sporozoites, but not CSP and AMA1 peptides were observed. Unlike peripheral blood, there was a high frequency of sporozoite-specific memory T cells observed in the liver and bone marrow. Interestingly, sporozoite-specific CD4+ and CD8+ memory T cells in the liver highly expressed chemokine receptors CCR5 and CXCR6, both of which are known for liver sinusoid homing. The majority of liver sporozoite-specific memory T cells expressed CD69, a phenotypic marker of tissue-resident memory (TRM) cells, which are well positioned to rapidly control liver-stage infection. Vaccine strategies that aim to elicit large number of liver TRM cells may efficiently increase the efficacy and durability of response against pre-erythrocytic parasites. PMID:28182750

  9. Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

    PubMed

    Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

    1999-12-01

    The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy

  10. Regulation of autophagy by cytoplasmic p53.

    PubMed

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  11. Neurofascin and Compact Myelin Antigen-Specific T Cell Response Pattern in Chronic Inflammatory Demyelinating Polyneuropathy Subtypes.

    PubMed

    Diederich, Jan-Markus; Staudt, Maximilian; Meisel, Christian; Hahn, Katrin; Meinl, Edgar; Meisel, Andreas; Klehmet, Juliane

    2018-01-01

    The objective of this study is to investigate whether chronic inflammatory demyelinating polyneuropathy (CIDP) and its subtypes differ in their type 1 T-helper (TH1) cell response against nodal/paranodal neurofascin (NF186, NF155) as well as myelin protein zero (P0 180-199) and myelin basic protein (MBP 82-100). Interferon-gamma (IFN-γ) enzyme-linked immunospot assay was used to detect antigen-specific T cell responses in 48 patients suffering typical CIDP ( n  = 18), distal acquired demyelinating polyneuropathy ( n  = 8), multifocal acquired demyelinating sensory and motor polyneuropathy (MADSAM; n  = 9), and sensory CIDP ( n  = 13) compared to other non-immune polyneuropathy (ON; n  = 19) and healthy controls ( n  = 9). Compared to controls, MADSAM and sensory CIDP patients showed broadest IFN-γ T cell responses to all four antigens. Positive IFN-γ responses against two or more antigens were highly predictive for CIDP (positive predictive value = 0.95) and were found in 77% of CIDP patients. Patients with limited antigen-specific response were females, more severely affected with neuropathic pain and proximal paresis. The area under the receiver operating characteristics curve (AUC) of NF186 in MADSAM was 0.94 [95% confidential interval (CI) 0.82-1.00] compared to ON. For sensory CIDP, AUC of P0 180-199 was 0.94 (95% CI 0.86-1.00) and for MBP 82-100 0.95 (95% CI 0.88-1.00) compared to ON. Cell-mediated immune responses to (para)nodal and myelin-derived antigens are common in CIDP. TH1 response against NF186 may be used as a biomarker for MADSAM and TH1 responses against P0 180-199 and MBP 82-100 as biomarkers for sensory CIDP. Larger multicenter studies study are warranted in order to establish these immunological markers as a diagnostic tools.

  12. A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

    PubMed Central

    Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

    2018-01-01

    Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

  13. A High Frequency of HIV-Specific Circulating Follicular Helper T Cells Is Associated with Preserved Memory B Cell Responses in HIV Controllers.

    PubMed

    Claireaux, M; Galperin, M; Benati, D; Nouël, A; Mukhopadhyay, M; Klingler, J; de Truchis, P; Zucman, D; Hendou, S; Boufassa, F; Moog, C; Lambotte, O; Chakrabarti, L A

    2018-05-08

    Follicular helper T cells (Tfh) play an essential role in the affinity maturation of the antibody response by providing help to B cells. To determine whether this CD4 + T cell subset may contribute to the spontaneous control of HIV infection, we analyzed the phenotype and function of circulating Tfh (cTfh) in patients from the ANRS CO21 CODEX cohort who naturally controlled HIV-1 replication to undetectable levels and compared them to treated patients with similarly low viral loads. HIV-specific cTfh (Tet + ), detected by Gag-major histocompatibility complex class II (MHC-II) tetramer labeling in the CD45RA - CXCR5 + CD4 + T cell population, proved more frequent in the controller group ( P = 0.002). The frequency of PD-1 expression in Tet + cTfh was increased in both groups (median, >75%) compared to total cTfh (<30%), but the intensity of PD-1 expression per cell remained higher in the treated patient group ( P = 0.02), pointing to the persistence of abnormal immune activation in treated patients. The function of cTfh, analyzed by the capacity to promote IgG secretion in cocultures with autologous memory B cells, did not show major differences between groups in terms of total IgG production but proved significantly more efficient in the controller group when measuring HIV-specific IgG production. The frequency of Tet + cTfh correlated with HIV-specific IgG production ( R = 0.71 for Gag-specific and R = 0.79 for Env-specific IgG, respectively). Taken together, our findings indicate that key cTfh-B cell interactions are preserved in controlled HIV infection, resulting in potent memory B cell responses that may play an underappreciated role in HIV control. IMPORTANCE The rare patients who spontaneously control HIV replication in the absence of therapy provide a unique model to identify determinants of an effective anti-HIV immune response. HIV controllers show signs of particularly efficient antiviral T cell responses, while their humoral response was until recently

  14. Grass-specific CD4(+) T-cells exhibit varying degrees of cross-reactivity, implications for allergen-specific immunotherapy.

    PubMed

    Archila, L D; DeLong, J H; Wambre, E; James, E A; Robinson, D M; Kwok, W W

    2014-07-01

    Conceptually, allergic responses may involve cross-reactivity by antibodies or T-cells. While IgE cross-reactivity among grass-pollen allergens has been observed, cross-reactivity at the allergen-specific T-cell level has been less documented. Identification of the patterns of cross-reactivity may improve our understanding, allowing optimization of better immunotherapy strategies. We use Phleum pratense as model for the studying of cross-reactivity at the allergen-specific CD4(+) T cell level among DR04:01 restricted Pooideae grass-pollen T-cell epitopes. After in vitro culture of blood mono-nucleated cells from grass-pollen-allergic subjects with specific Pooideae antigenic epitopes, dual tetramer staining with APC-labelled DR04:01/Phleum pratense tetramers and PE-labelled DR04:01/Pooideae grass homolog tetramers was assessed to identify cross-reactivity among allergen-specific DR04:01-restricted T-cells in six subjects. Direct ex vivo staining enabled the comparison of frequency and phenotype of different Pooideae grass-pollen reactive T-cells. Intracellular cytokine staining (ICS) assays were also used to examine phenotypes of these T-cells. T-cells with various degrees of cross-reactive profiles could be detected. Poa p 1 97-116 , Lol p 1 221-240 , Lol p 5a 199-218 , and Poa p 5a 199-218 were identified as minimally cross-reactive T-cell epitopes that do not show cross-reactivity to Phl p 1 and Phl p 5a epitopes. Ex vivo tetramer staining assays demonstrated T-cells that recognized these minimally cross-reactive T-cell epitopes are present in Grass-pollen-allergic subjects. Our results suggest that not all Pooideae grass epitopes with sequence homology are cross-reactive. Non-cross-reactive T-cells with comparable frequency, phenotype and functionality to Phl p-specific T-cells suggest that a multiple allergen system should be considered for immunotherapy instead of a mono-allergen system. © 2014 John Wiley & Sons Ltd.

  15. Compartmentalization of immune responses in human tuberculosis: few CD8+ effector T cells but elevated levels of FoxP3+ regulatory t cells in the granulomatous lesions.

    PubMed

    Rahman, Sayma; Gudetta, Berhanu; Fink, Joshua; Granath, Anna; Ashenafi, Senait; Aseffa, Abraham; Derbew, Milliard; Svensson, Mattias; Andersson, Jan; Brighenti, Susanna Grundström

    2009-06-01

    Immune responses were assessed at the single-cell level in lymph nodes from children with tuberculous lymphadenitis. Tuberculosis infection was associated with tissue remodeling of lymph nodes as well as altered cellular composition. Granulomas were significantly enriched with CD68+ macrophages expressing the M. tuberculosis complex-specific protein antigen MPT64 and inducible nitric oxide synthase. There was a significant increase in CD8+ cytolytic T cells surrounding the granuloma; however, CD8+ T cells expressed low levels of the cytolytic and antimicrobial effector molecules perforin and granulysin in the granulomatous lesions. Quantitative real-time mRNA analysis revealed that interferon-gamma, tumor necrosis factor-alpha, and interleukin-17 were not up-regulated in infected lymph nodes, but there was a significant induction of both transforming growth factor-beta and interleukin-13. In addition, granulomas contained an increased number of CD4+FoxP3+ T cells co-expressing the immunoregulatory cytotoxic T-lymphocyte antigen-4 and glucocorticoid-induced tumor necrosis factor receptor molecules. Low numbers of CD8+ T cells in the lesions correlated with high levels of transforming growth factor-beta and FoxP3+ regulatory T cells, suggesting active immunosuppression at the local infection site. Compartmentalization and skewing of the immune response toward a regulatory phenotype may result in an uncoordinated effector T-cell response that reduces granule-mediated killing of M. tuberculosis-infected cells and subsequent disease control.

  16. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yi Fuming; Saha, Abhik; Murakami, Masanao

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

  17. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiran, Shashi; Oddi, Vineesha; Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose ofmore » doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA

  18. Mechanisms that enhance sustainability of p53 pulses.

    PubMed

    Kim, Jae Kyoung; Jackson, Trachette L

    2013-01-01

    The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

  19. Specific CD8+ T Cell Responses Correlate with Control of Simian Immunodeficiency Virus Replication in Mauritian Cynomolgus Macaques

    PubMed Central

    Budde, Melisa L.; Greene, Justin M.; Chin, Emily N.; Ericsen, Adam J.; Scarlotta, Matthew; Cain, Brian T.; Pham, Ngoc H.; Becker, Ericka A.; Harris, Max; Weinfurter, Jason T.; O'Connor, Shelby L.; Piatak, Michael; Lifson, Jeffrey D.; Gostick, Emma; Price, David A.; Friedrich, Thomas C.

    2012-01-01

    Specific major histocompatibility complex (MHC) class I alleles are associated with an increased frequency of spontaneous control of human and simian immunodeficiency viruses (HIV and SIV). The mechanism of control is thought to involve MHC class I-restricted CD8+ T cells, but it is not clear whether particular CD8+ T cell responses or a broad repertoire of epitope-specific CD8+ T cell populations (termed T cell breadth) are principally responsible for mediating immunologic control. To test the hypothesis that heterozygous macaques control SIV replication as a function of superior T cell breadth, we infected MHC-homozygous and MHC-heterozygous cynomolgus macaques with the pathogenic virus SIVmac239. As measured by a gamma interferon enzyme-linked immunosorbent spot assay (IFN-γ ELISPOT) using blood, T cell breadth did not differ significantly between homozygotes and heterozygotes. Surprisingly, macaques that controlled SIV replication, regardless of their MHC zygosity, shared durable T cell responses against similar regions of Nef. While the limited genetic variability in these animals prevents us from making generalizations about the importance of Nef-specific T cell responses in controlling HIV, these results suggest that the T cell-mediated control of virus replication that we observed is more likely the consequence of targeting specificity rather than T cell breadth. PMID:22573864

  20. Trypanosoma cruzi Subverts Host Cell Sialylation and May Compromise Antigen-specific CD8+ T Cell Responses*

    PubMed Central

    Freire-de-Lima, Leonardo; Alisson-Silva, Frederico; Carvalho, Sebastião T.; Takiya, Christina M.; Rodrigues, Maurício M.; DosReis, George A.; Mendonça-Previato, Lucia; Previato, José O.; Todeschini, Adriane R.

    2010-01-01

    Upon activation, cytotoxic CD8+ T lymphocytes are desialylated exposing β-galactose residues in a physiological change that enhances their effector activity and that can be monitored on the basis of increased binding of the lectin peanut agglutinin. Herein, we investigated the impact of sialylation mediated by trans-sialidase, a specific and unique Trypanosoma transglycosylase for sialic acid, on CD8+ T cell response of mice infected with T. cruzi. Our data demonstrate that T. cruzi uses its trans-sialidase enzyme to resialylate the CD8+ T cell surface, thereby dampening antigen-specific CD8+ T cell response that might favor its own persistence in the mammalian host. Binding of the monoclonal antibody S7, which recognizes sialic acid-containing epitopes on the 115-kDa isoform of CD43, was augmented on CD8+ T cells from ST3Gal-I-deficient infected mice, indicating that CD43 is one sialic acid acceptor for trans-sialidase activity on the CD8+ T cell surface. The cytotoxic activity of antigen-experienced CD8+ T cells against the immunodominant trans-sialidase synthetic peptide IYNVGQVSI was decreased following active trans-sialidase- mediated resialylation in vitro and in vivo. Inhibition of the parasite's native trans-sialidase activity during infection strongly decreased CD8+ T cell sialylation, reverting it to the glycosylation status expected in the absence of parasite manipulation increasing mouse survival. Taken together, these results demonstrate, for the first time, that T. cruzi subverts sialylation to attenuate CD8+ T cell interactions with peptide-major histocompatibility complex class I complexes. CD8+ T cell resialylation may represent a sophisticated strategy to ensure lifetime host parasitism. PMID:20106975

  1. Nasopharyngeal infection by Streptococcus pyogenes requires superantigen-responsive Vβ-specific T cells

    PubMed Central

    Zeppa, Joseph J.; Kasper, Katherine J.; Mohorovic, Ivor; Mazzuca, Delfina M.

    2017-01-01

    The globally prominent pathogen Streptococcus pyogenes secretes potent immunomodulatory proteins known as superantigens (SAgs), which engage lateral surfaces of major histocompatibility class II molecules and T-cell receptor (TCR) β-chain variable domains (Vβs). These interactions result in the activation of numerous Vβ-specific T cells, which is the defining activity of a SAg. Although streptococcal SAgs are known virulence factors in scarlet fever and toxic shock syndrome, mechanisms by how SAgs contribute to the life cycle of S. pyogenes remain poorly understood. Herein, we demonstrate that passive immunization against the Vβ8-targeting SAg streptococcal pyrogenic exotoxin A (SpeA), or active immunization with either wild-type or a nonfunctional SpeA mutant, protects mice from nasopharyngeal infection; however, only passive immunization, or vaccination with inactive SpeA, resulted in high-titer SpeA-specific antibodies in vivo. Mice vaccinated with wild-type SpeA rendered Vβ8+ T cells poorly responsive, which prevented infection. This phenotype was reproduced with staphylococcal enterotoxin B, a heterologous SAg that also targets Vβ8+ T cells, and rendered mice resistant to infection. Furthermore, antibody-mediated depletion of T cells prevented nasopharyngeal infection by S. pyogenes, but not by Streptococcus pneumoniae, a bacterium that does not produce SAgs. Remarkably, these observations suggest that S. pyogenes uses SAgs to manipulate Vβ-specific T cells to establish nasopharyngeal infection. PMID:28794279

  2. The ThPOK transcription factor differentially affects the development and function of self-specific CD8(+) T cells and regulatory CD4(+) T cells.

    PubMed

    Twu, Yuh-Ching; Teh, Hung-Sia

    2014-03-01

    The zinc finger transcription factor ThPOK plays a crucial role in CD4 T-cell development and CD4/CD8 lineage decision. In ThPOK-deficient mice, developing T cells expressing MHC class II-restricted T-cell receptors are redirected into the CD8 T-cell lineage. In this study, we investigated whether the ThPOK transgene affected the development and function of two additional types of T cells, namely self-specific CD8 T cells and CD4(+) FoxP3(+) T regulatory cells. Self-specific CD8 T cells are characterized by high expression of CD44, CD122, Ly6C, 1B11 and proliferation in response to either IL-2 or IL-15. The ThPOK transgene converted these self-specific CD8 T cells into CD4 T cells. The converted CD4(+) T cells are no longer self-reactive, lose the characteristics of self-specific CD8 T cells, acquire the properties of conventional CD4 T cells and survive poorly in peripheral lymphoid organs. By contrast, the ThPOK transgene promoted the development of CD4(+) FoxP3(+) regulatory T cells resulting in an increased recovery of CD4(+) FoxP3(+) regulatory T cells that expressed higher transforming growth factor-β-dependent suppressor activity. These studies indicate that the ThPOK transcription factor differentially affects the development and function of self-specific CD8 T cells and CD4(+) FoxP3(+) regulatory T cells. © 2013 John Wiley & Sons Ltd.

  3. KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

    PubMed Central

    Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

    2017-01-01

    Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

  4. Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

    PubMed Central

    Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

    2009-01-01

    Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

  5. Normalized Synergy Predicts That CD8 Co-Receptor Contribution to T Cell Receptor (TCR) and pMHC Binding Decreases As TCR Affinity Increases in Human Viral-Specific T Cells

    PubMed Central

    Williams, Chad M.; Schonnesen, Alexandra A.; Zhang, Shu-Qi; Ma, Ke-Yue; He, Chenfeng; Yamamoto, Tori; Eckhardt, S. Gail; Klebanoff, Christopher A.; Jiang, Ning

    2017-01-01

    The discovery of naturally occurring T cell receptors (TCRs) that confer specific, high-affinity recognition of pathogen and cancer-associated antigens remains a major goal in cellular immunotherapies. The contribution of the CD8 co-receptor to the interaction between the TCR and peptide-bound major histocompatibility complex (pMHC) has previously been correlated with the activation and responsiveness of CD8+ T cells. However, these studies have been limited to model systems of genetically engineered hybridoma TCRs or transgenic mouse TCRs against either a single epitope or an array of altered peptide ligands. CD8 contribution in a native human antigen-specific T cell response remains elusive. Here, using Hepatitis C Virus-specific precursor CTLs spanning a large range of TCR affinities, we discovered that the functional responsiveness of any given TCR correlated with the contribution of CD8 to TCR/pMHC binding. Furthermore, we found that CD8 contribution to TCR/pMHC binding in the two-dimensional (2D) system was more accurately reflected by normalized synergy (CD8 cooperation normalized by total TCR/pMHC bonds) rather than synergy (total CD8 cooperation) alone. While synergy showed an increasing trend with TCR affinity, normalized synergy was demonstrated to decrease with the increase of TCR affinity. Critically, normalized synergy was shown to correlate with CTL functionality and peptide sensitivity, corroborating three-dimensional (3D) analysis of CD8 contribution with respect to TCR affinity. In addition, we identified TCRs that were independent of CD8 for TCR/pMHC binding. Our results resolve the current discrepancy between 2D and 3D analysis on CD8 contribution to TCR/pMHC binding, and demonstrate that naturally occurring high-affinity TCRs are more capable of CD8-independent interactions that yield greater functional responsiveness even with CD8 blocking. Taken together, our data suggest that addition of the normalized synergy parameter to our previously

  6. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  7. Heterologous prime-boost regimens with a recombinant chimpanzee adenoviral vector and adjuvanted F4 protein elicit polyfunctional HIV-1-specific T-Cell responses in macaques.

    PubMed

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides

  8. Ionizing Radiation-Induced Responses in Human Cells with Differing TP53 Status

    PubMed Central

    Mirzayans, Razmik; Andrais, Bonnie; Scott, April; Wang, Ying W.; Murray, David

    2013-01-01

    Ionizing radiation triggers diverse responses in human cells encompassing apoptosis, necrosis, stress-induced premature senescence (SIPS), autophagy, and endopolyploidy (e.g., multinucleation). Most of these responses result in loss of colony-forming ability in the clonogenic survival assay. However, not all modes of so-called clonogenic cell “death” are necessarily advantageous for therapeutic outcome in cancer radiotherapy. For example, the crosstalk between SIPS and autophagy is considered to influence the capacity of the tumor cells to maintain a prolonged state of growth inhibition that unfortunately can be succeeded by tumor regrowth and disease recurrence. Likewise, endopolyploid giant cells are able to segregate into near diploid descendants that continue mitotic activities. Herein we review the current knowledge on the roles that the p53 and p21WAF1 tumor suppressors play in determining the fate of human fibroblasts (normal and Li-Fraumeni syndrome) and solid tumor-derived cells after exposure to ionizing radiation. In addition, we discuss the important role of WIP1, a p53-regulated oncogene, in the temporal regulation of the DNA damage response and its contribution to p53 dynamics post-irradiation. This article highlights the complexity of the DNA damage response and provides an impetus for rethinking the nature of cancer cell resistance to therapeutic agents. PMID:24232458

  9. TRIM65 negatively regulates p53 through ubiquitination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yang; Ma, Chengyuan; Zhou, Tong

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

  10. p53 regulates mesenchymal stem cell-mediated tumor suppression in a tumor microenvironment through immune modulation.

    PubMed

    Huang, Y; Yu, P; Li, W; Ren, G; Roberts, A I; Cao, W; Zhang, X; Su, J; Chen, X; Chen, Q; Shou, P; Xu, C; Du, L; Lin, L; Xie, N; Zhang, L; Wang, Y; Shi, Y

    2014-07-17

    p53 is one of the most studied genes in cancer biology, and mutations in this gene may be predictive for the development of many types of cancer in humans and in animals. However, whether p53 mutations in non-tumor stromal cells can affect tumor development has received very little attention. In this study, we show that B16F0 melanoma cells form much larger tumors in p53-deficient mice than in wild-type mice, indicating a potential role of p53 deficiency in non-tumor cells of the microenvironment. As mesenchymal stem cells (MSCs) are attracted to tumors and form a major component of the tumor microenvironment, we examined the potential role of p53 status in MSCs in tumor development. We found that larger tumors resulted when B16F0 melanoma cells were co-injected with bone marrow MSCs derived from p53-deficient mice rather than MSCs from wild-type mice. Interestingly, this tumor-promoting effect by p53-deficient MSCs was not observed in non-obese diabetic/severe combined immunodeficiency mice, indicating the immune response has a critical role. Indeed, in the presence of inflammatory cytokines, p53-deficient MSCs expressed more inducible nitric oxide synthase (iNOS) and exhibited greater immunosuppressive capacity. Importantly, tumor promotion by p53-deficient MSCs was abolished by administration of S-methylisothiourea, an iNOS inhibitor. Therefore, our data demonstrate that p53 status in tumor stromal cells has a key role in tumor development by modulating immune responses.

  11. Alterations of p53 in tumorigenic human bronchial epithelial cells correlate with metastatic potential

    NASA Technical Reports Server (NTRS)

    Piao, C. Q.; Willey, J. C.; Hei, T. K.; Hall, E. J. (Principal Investigator)

    1999-01-01

    The cellular and molecular mechanisms of radiation-induced lung cancer are not known. In the present study, alterations of p53 in tumorigenic human papillomavirus-immortalized human bronchial epithelial (BEP2D) cells induced by a single low dose of either alpha-particles or 1 GeV/nucleon (56)Fe were analyzed by PCR-single-stranded conformation polymorphism (SSCP) coupled with sequencing analysis and immunoprecipitation assay. A total of nine primary and four secondary tumor cell lines, three of which were metastatic, together with the parental BEP2D and primary human bronchial epithelial (NHBE) cells were studied. The immunoprecipitation assay showed overexpression of mutant p53 proteins in all the tumor lines but not in NHBE and BEP2D cells. PCR-SSCP and sequencing analysis found band shifts and gene mutations in all four of the secondary tumors. A G-->T transversion in codon 139 in exon 5 that replaced Lys with Asn was detected in two tumor lines. One mutation each, involving a G-->T transversion in codon 215 in exon 6 (Ser-->lle) and a G-->A transition in codon 373 in exon 8 (Arg-->His), was identified in the remaining two secondary tumors. These results suggest that p53 alterations correlate with tumorigenesis in the BEP2D cell model and that mutations in the p53 gene may be indicative of metastatic potential.

  12. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

    PubMed

    Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

    2017-11-03

    Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping

  13. Therapeutic targeting of the p53 pathway in cancer stem cells

    PubMed Central

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  14. Enhanced radiosensitization of p53 mutant cells by oleamide.

    PubMed

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil

    2006-04-01

    Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  15. mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

    PubMed Central

    Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

  16. T-cell receptor transfer for boosting HIV-1-specific T-cell immunity in HIV-1-infected patients.

    PubMed

    Mummert, Christiane; Hofmann, Christian; Hückelhoven, Angela G; Bergmann, Silke; Mueller-Schmucker, Sandra M; Harrer, Ellen G; Dörrie, Jan; Schaft, Niels; Harrer, Thomas

    2016-09-10

    Strategies to cure HIV-1 infection require the eradication of viral reservoirs. An innovative approach for boosting the cytotoxic T-lymphocyte response is the transfer of T-cell receptors (TCRs). Previously, we have shown that electroporation of TCR-encoding mRNA is able to reprogram CD8 T cells derived from healthy donors. So far, it is unknown whether the transfer of HIV-1-specific TCRs is capable to reprogram CD8 T cells of HIV-1-infected patients. To assess the efficiency of TCR-transfer by mRNA electroporation and the functionality of reprogramed T cells in HIV-1-infected patients, we performed an in-vitro analysis of TCR-transfer into T cells from HIV-1-infected patients in various stages of disease and from healthy controls. Peripheral blood mononuclear cells from 16 HIV-1-infected patients (nine HLA-A02-positive, seven HLA-A02-negative) and from five healthy controls were electroporated with mRNA-constructs encoding TCRs specific for the HLA-A02/HIV-1-gag p17 epitope SLYNTVATL (SL9). Functionality of the TCRs was measured by γIFN-ELISpot assays. SL9/TCR transfection into peripheral blood mononuclear cells from both HLA-A02-positive and HLA-A02-negative HIV-1-infected patients and from healthy blood donors reprogramed T cells for recognition of SL9-presenting HLA-A02-positive cells in γIFN-ELISpot assays. SL9/TCR-transfer into T cells from an immunodeficient AIDS patient could induce recognition of SL9-expressing target cells only after reversion of T-cell dysfunction by antiretroviral therapy. The transfer of HIV-1-p17-specific TCRs into T cells is functional both in HIV-1-infected patients as well as in healthy blood donors. TCR-transfer is a promising method to boost the immune system against HIV-1.

  17. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    PubMed

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  18. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

  19. Tyrosinase overexpression promotes ATM-dependent p53 phosphorylation by quercetin and sensitizes melanoma cells to dacarbazine.

    PubMed

    Thangasamy, Thilakavathy; Sittadjody, Sivanandane; Limesand, Kirsten H; Burd, Randy

    2008-01-01

    Dacarbazine (DTIC) has been used for the treatment of melanoma for decades. However, monotherapy with this chemotherapeutic agent results only in moderate response rates. To improve tumor response to DTIC current clinical trials in melanoma focus on combining a novel targeted agent with chemotherapy. Here, we demonstrate that tyrosinase which is commonly overexpressed in melanoma activates the bioflavonoid quercetin (Qct) and promotes an ataxia telangiectasia mutated (ATM)-dependent DNA damage response. This response sensitizes melanoma cells that overexpress tyrosinase to DTIC. In DB-1 melanoma cells that overexpress tyrosinase (Tyr(+) cells), the threshold for phosphorylation of ATM and p53 at serine 15 was observed at a low dose of Qct (25 microM) when compared to the mock transfected pcDNA3 cells, which required a higher dose (75 microM). Both pcDNA3 and Tyr(+) DB-1 cells demonstrated similar increases in phosphorylation of p53 at other serine sites, but in the Tyr(+) cells, DNApk expression was found to be reduced compared to control cells, indicating a shift towards an ATM-mediated response. The DB-1 control cells were resistant to DTIC, but were sensitized to apoptosis with high dose Qct, while Tyr(+) cells were sensitized to DTIC with low or high dose Qct. Qct also sensitized SK Mel 5 (p53 wildtype) and 28 (p53 mutant) cells to DTIC. However, when SK Mel 5 cells were transiently transfected with tyrosinase and treated with Qct plus DTIC, SK Mel 5 cells demonstrated a more than additive induction of apoptosis. Therefore, this study demonstrates that tyrosinase overexpression promotes an ATM-dependent p53 phosphorylation by Qct treatment and sensitizes melanoma cells to dacarbazine. In conclusion, these results suggest that Qct or Qct analogues may significantly improve DTIC response rates in tumors that express tyrosinase.

  20. Tyrosinase Overexpression Promotes ATM-Dependent p53 Phosphorylation by Quercetin and Sensitizes Melanoma Cells to Dacarbazine

    PubMed Central

    Thangasamy, Thilakavathy; Sittadjody, Sivanandane; H. Limesand, Kirsten; Burd, Randy

    2008-01-01

    Dacarbazine (DTIC) has been used for the treatment of melanoma for decades. However, monotherapy with this chemotherapeutic agent results only in moderate response rates. To improve tumor response to DTIC current clinical trials in melanoma focus on combining a novel targeted agent with chemotherapy. Here, we demonstrate that tyrosinase which is commonly overexpressed in melanoma activates the bioflavonoid quercetin (Qct) and promotes an ataxia telangiectasia mutated (ATM)-dependent DNA damage response. This response sensitizes melanoma cells that overexpress tyrosinase to DTIC. In DB-1 melanoma cells that overexpress tyrosinase (Tyr cells), the threshold for phosphorylation of ATM and p53 at serine 15 was observed at a low dose of Qct (25 μM) when compared to the mock transfected pcDNA3 cells, which required a higher dose (75 μM). Both pcDNA3 and Tyr DB-1 cells demonstrated similar increases in phosphorylation of p53 at other serine sites, but in the Tyr cells, DNApk expression was found to be reduced compared to control cells, indicating a shift towards an ATM-mediated response. The DB-1 control cells were resistant to DTIC, but were sensitized to apoptosis with high dose Qct, while Tyr cells were sensitized to DTIC with low or high dose Qct. Qct also sensitized SK Mel 5 (p53 wildtype) and 28 (p53 mutant) cells to DTIC. However, when SK Mel 5 cells were transiently transfected with tyrosinase and treated with Qct plus DTIC, SK Mel 5 cells demonstrated a more than additive induction of apoptosis. Therefore, this study demonstrates that tyrosinase overexpression promotes an ATM-dependent p53 phosphorylation by Qct treatment and sensitizes melanoma cells to dacarbazine. In conclusion, these results suggest that Qct or Qct analogues may significantly improve DTIC response rates in tumors that express tyrosinase. PMID:18791269

  1. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses

    PubMed Central

    Rubbi, Carlos P.; Milner, Jo

    2003-01-01

    p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953

  2. Mutant p53-Expressing Cells Undergo Necroptosis via Cell Competition with the Neighboring Normal Epithelial Cells.

    PubMed

    Watanabe, Hirotaka; Ishibashi, Kojiro; Mano, Hiroki; Kitamoto, Sho; Sato, Nanami; Hoshiba, Kazuya; Kato, Mugihiko; Matsuzawa, Fumihiko; Takeuchi, Yasuto; Shirai, Takanobu; Ishikawa, Susumu; Morioka, Yuka; Imagawa, Toshiaki; Sakaguchi, Kazuyasu; Yonezawa, Suguru; Kon, Shunsuke; Fujita, Yasuyuki

    2018-06-26

    p53 is a tumor suppressor protein, and its missense mutations are frequently found in human cancers. During the multi-step progression of cancer, p53 mutations generally accumulate at the mid or late stage, but not in the early stage, and the underlying mechanism is still unclear. In this study, using mammalian cell culture and mouse ex vivo systems, we demonstrate that when p53R273H- or p53R175H-expressing cells are surrounded by normal epithelial cells, mutant p53 cells undergo necroptosis and are basally extruded from the epithelial monolayer. When mutant p53 cells alone are present, cell death does not occur, indicating that necroptosis results from cell competition with the surrounding normal cells. Furthermore, when p53R273H mutation occurs within RasV12-transformed epithelia, cell death is strongly suppressed and most of the p53R273H-expressing cells remain intact. These results suggest that the order of oncogenic mutations in cancer development could be dictated by cell competition. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  3. P16/p53 expression and telomerase activity in immortalized human dental pulp cells

    PubMed Central

    Egbuniwe, Obi; Idowu, Bernadine D; Funes, Juan M; Grant, Andrew D; Renton, Tara

    2011-01-01

    Introduction Residing within human dental pulp are cells of an ectomesenchymal origin that have the potential to differentiate into odontoblast-like cells. These cells have a limited growth potential owing to the effects of cell senescence. This study examines the effects of immortalizing odontoblast-like cells on cell proliferation and mineralization by comparing transformed dental pulp stem cells (tDPSCs) and non-transformed dental pulp stem cells (nDPSCs). Results With the exogenous expression of hTERT, tDPSCs maintained a continued expression of odontogenic markers for cell proliferation and mineralization (ALP, COL-1, DMP-1, DSPP, OCN and OPN), as did nDPSCs. Oncoprotein expression was seen in both groups except for a noted absence of p16 in the tDPSCs. nDPSCs also showed lower levels of total ALP and DNA activity in comparison to tDPSCs when assayed, as well as low telomerase activity readings. Methods Using a retroviral vector, exogenous human telomerase reverse transcriptase (hTERT) was expressed in tDPSCs. Both cell groups were cultured, and their telomerase activities were determined using a telomerase quantification assay. Also examined, were the expression of genes involved in proliferation and mineralization, such as human alkaline phosphatase (ALP), β-actin, collagen I (col-1), core binding factor (cbfa)-1, dentin matrix protein (DMP-1), dentin sialophosphoprotein (DSPP), GAPDH, hTERT, osteocalcin (OCN), osteopontin (OPN) as well as oncoproteins involved in senescence (p16, p21 and p53) using RT-PCR. DNA and alkaline phosphate activity was also assayed in both cell groups. Conclusion These results indicate maintenance of odontoblast-like differentiation characteristics after retroviral transformation with hTERT and suggest a possible link with a reduced p16 expression. PMID:22067611

  4. p53 as an Effector or Inhibitor of Therapy Response

    PubMed Central

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2016-01-01

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. PMID:26637438

  5. An Enhanced ELISPOT Assay for Sensitive Detection of Antigen-Specific T Cell Responses to Borrelia burgdorferi

    PubMed Central

    Jin, Chenggang; Roen, Diana R.; Lehmann, Paul V.; Kellermann, Gottfried H.

    2013-01-01

    Lyme Borreliosis is an infectious disease caused by the spirochete Borrelia burgdorferi that is transmitted through the bite of infected ticks. Both B cell-mediated humoral immunity and T cell immunity develop during natural Borrelia infection. However, compared with humoral immunity, the T cell response to Borrelia infection has not been well elucidated. In this study, a novel T cell-based assay was developed and validated for the sensitive detection of antigen-specific T cell response to B. burgdorferi. Using interferon-γ as a biomarker, we developed a new enzyme-linked immunospot method (iSpot LymeTM) to detect Borrelia antigen-specific effector/memory T cells that were activated in vivo by exposing them to recombinant Borrelia antigens ex vivo. To test this new method as a potential laboratory diagnostic tool, we performed a clinical study with a cohort of Borrelia positive patients and healthy controls. We demonstrated that the iSpot Lyme assay has a significantly higher specificity and sensitivity compared with the Western Blot assay that is currently used as a diagnostic measure. A comprehensive evaluation of the T cell response to Borrelia infection should, therefore, provide new insights into the pathogenesis, diagnosis, treatment and monitoring of Lyme disease. PMID:24709800

  6. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.

    PubMed

    Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M

    2015-06-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.

  7. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    PubMed Central

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  8. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.

    PubMed

    Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete

    2018-06-11

    CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.

  9. Functionality of Dengue Virus Specific Memory T Cell Responses in Individuals Who Were Hospitalized or Who Had Mild or Subclinical Dengue Infection

    PubMed Central

    Jeewandara, Chandima; Adikari, Thiruni N.; Gomes, Laksiri; Fernando, Samitha; Fernando, R. H.; Perera, M. K. T.; Ariyaratne, Dinuka; Kamaladasa, Achala; Salimi, Maryam; Prathapan, Shamini

    2015-01-01

    Background Although antibody responses to dengue virus (DENV) in naturally infected individuals have been extensively studied, the functionality of DENV specific memory T cell responses in relation to clinical disease severity is incompletely understood. Methodology/Principal findings Using ex vivo IFNγ ELISpot assays, and by determining cytokines produced in ELISpot supernatants, we investigated the functionality of DENV-specific memory T cell responses in a large cohort of individuals from Sri Lanka (n=338), who were naturally infected and were either hospitalized due to dengue or had mild or sub clinical dengue infection. We found that T cells of individuals with both past mild or sub clinical dengue infection and who were hospitalized produced multiple cytokines when stimulated with DENV-NS3 peptides. However, while DENV-NS3 specific T cells of those with mild/sub clinical dengue infection were more likely to produce only granzyme B (p=0.02), those who were hospitalized were more likely to produce both TNFα and IFNγ (p=0.03) or TNFα alone. We have also investigated the usefulness of a novel T cell based assay, which can be used to determine the past infecting DENV serotype. 92.4% of DENV seropositive individuals responded to at least one DENV serotype of this assay and none of the seronegatives responded. Individuals who were seronegative, but had received the Japanese encephalitis vaccine too made no responses, suggesting that the peptides used in this assay did not cross react with the Japanese encephalitis virus. Conclusions/significance The types of cytokines produced by DENV-specific memory T cells appear to influence the outcome of clinical disease severity. The novel T cell based assay, is likely to be useful in determining the past infecting DENV serotype in immune-epidemiological studies and also in dengue vaccine trials. PMID:25875020

  10. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

    PubMed Central

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

    2013-01-01

    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  11. HBV-specific and global T-cell dysfunction in chronic hepatitis B

    PubMed Central

    Park, Jang-June; Wong, David K.; Wahed, Abdus S.; Lee, William M.; Feld, Jordan J.; Terrault, Norah; Khalili, Mandana; Sterling, Richard K.; Kowdley, Kris V.; Bzowej, Natalie; Lau, Daryl T.; Kim, W. Ray; Smith, Coleman; Carithers, Robert L.; Torrey, Keith W.; Keith, James W.; Levine, Danielle L.; Traum, Daniel; Ho, Suzanne; Valiga, Mary E.; Johnson, Geoffrey S.; Doo, Edward; Lok, Anna S. F.; Chang, Kyong-Mi

    2015-01-01

    Background & Aims T cells play a critical role in in viral infection. We examined whether T-cell effector and regulatory responses can define clinical stages of chronic hepatitis B (CHB). Methods We enrolled 200 adults with CHB who participated in the NIH-supported Hepatitis B Research Network from 2011 through 2013 and 20 uninfected individuals (controls). Peripheral blood lymphocytes from these subjects were analyzed for T-cell responses (proliferation and production of interferon-γ and interleukin-10) to overlapping hepatitis B virus (HBV) peptides (preS, S, preC, core, and reverse transcriptase), influenza matrix peptides, and lipopolysaccharide. T-cell expression of regulatory markers FOXP3, programmed death-1 (PD1), and cytotoxic T lymphocyte-associated antigen-4 (CTLA4) was examined by flow cytometry. Immune measures were compared with clinical parameters, including physician-defined immune-active, immune-tolerant, or inactive CHB phenotypes, in a blinded fashion. Results Compared to controls, patients with CHB had weak T-cell proliferative, interferon-γ, and interleukin-10 responses to HBV, with increased frequency of circulating FOXP3+CD127− regulatory T cells and CD4+ T-cell expression of PD1 and CTLA4. T-cell measures did not clearly distinguish between clinical CHB phenotypes, although the HBV core-specific T-cell response was weaker in HBeAg+ than HBeAg− patients (% responders: 3% vs 23%, P=.00008). Although in vitro blockade of PD1 or CTLA4 increased T-cell responses to HBV, the effect was weaker in HBeAg+ than HBeAg− patients. Furthermore, T-cell responses to influenza and lipopolysaccharide were weaker in CHB patients than controls. Conclusion HBV persists with virus-specific and global T-cell dysfunction mediated by multiple regulatory mechanisms including circulating HBeAg, but without distinct T-cell–based immune signatures for clinical phenotypes. These findings suggest additional T-cell independent or regulatory mechanisms of CHB

  12. p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

    PubMed

    Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

    1996-12-20

    In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

  13. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    PubMed

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  14. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less

  15. Ki-67 expression reveals strong, transient influenza specific CD4 T cell responses after adult vaccination.

    PubMed

    Li, Xi; Miao, Hongyu; Henn, Alicia; Topham, David J; Wu, Hulin; Zand, Martin S; Mosmann, Tim R

    2012-06-29

    Although previous studies have found minimal changes in CD4 T cell responses after vaccination of adults with trivalent inactivated influenza vaccine, daily sampling and monitoring of the proliferation marker Ki-67 have now been used to reveal that a substantial fraction of influenza-specific CD4 T cells respond to vaccination. At 4-6 days after vaccination, there is a sharp rise in the numbers of Ki-67-expressing PBMC that produce IFNγ, IL-2 and/or TNFα in vitro in response to influenza vaccine or peptide. Ki-67(+) cell numbers then decline rapidly, and 10 days after vaccination, both Ki-67(+) and overall influenza-specific cell numbers are similar to pre-vaccination levels. These results provide a tool for assessing the quality and quantity of CD4 T cell responses to different influenza vaccines, and raise the possibility that the anti-influenza T cell memory response may be qualitatively altered by vaccination, even if the overall memory cell numbers do not change significantly. Copyright © 2012. Published by Elsevier Ltd.

  16. Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway

    PubMed Central

    Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.

    2011-01-01

    Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980

  17. Antigen-specific T cell therapies for cancer

    PubMed Central

    Manzo, Teresa; Heslop, Helen E.; Rooney, Cliona M.

    2015-01-01

    Adoptively transferred antigen-specific T cells that recognize tumor antigens through their native receptors have many potential benefits as treatment for virus-associated diseases and malignancies, due to their ability to selectively recognize tumor antigens, expand and persist to provide long-term protection. Infusions of T cells targeting Epstein–Barr virus (EBV) antigens have shown encouraging response rates in patients with post-transplant lymphoproliferative disease as well as EBV-positive lymphomas and nasopharyngeal cancer, although a recent study also showed that human papilloma virus-reactive T cells can induce complete regression of metastatic cervical cancer. This strategy is also being evaluated to target non-viral tumor-associated antigens. Targeting these less immunogenic antigens is more challenging, as tumor antigens are generally weak, and high avidity T cells specific for self-antigens are deleted in the thymus, but tumor responses have been reported. Current research focusses on defining factors that promote in vivo persistence of transferred cells and ameliorate the immunosuppressive microenvironment. To this end, investigators are evaluating the effects of combining adoptive transfer of antigen-specific T cells with other immunotherapy moieties such as checkpoint inhibitors. Genetic modification of infused T cells may also be used to overcome tumor evasion mechanisms, and vaccines may be used to promote in vivo proliferation. PMID:26160910

  18. The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines

    PubMed Central

    2012-01-01

    Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the

  19. p53 as an Effector or Inhibitor of Therapy Response.

    PubMed

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2015-12-04

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  20. Potent CD4+ T-cell epitope P30 enhances HER2/neu-engineered dendritic cell-induced immunity against Tg1-1 breast cancer in transgenic FVBneuN mice by enhanced CD4+ T-cell-stimulated CTL responses.

    PubMed

    Xie, Y; Chen, Y; Ahmed, K A; Li, W; Ahmed, S; Sami, A; Chibbar, R; Tang, X; Tao, M; Xu, J; Xiang, J

    2013-10-01

    One of the major obstacles in human epidermal growth factor receptor (HER)-2/neu-specific trastuzumab immunotherapy of HER2/neu-positive breast cancer is the development of trastuzumab resistance, warranting the search for other therapeutic strategies. Although dendritic cell (DC) vaccines have been extensively applied in clinical trials for cancer treatment, the vaccination efficacy is still limited, mostly because DC vaccines are not sufficient to break tumor-associated antigen-specific self-immune tolerance in cancer patients. P30 (FNNFTVSFWLRVPKVSASHLE) derived from tetanus toxin is a universally potent CD4(+) T helper epitope capable of enhancing CD8(+) cytotoxic T-lymphocyte (CTL) responses. In this study, we constructed two recombinant adenoviral vectors (AdVs), AdVOVA-P30 and AdVHER2/neu-P30, expressing ovalbumin (OVA)-P30 and HER2/neu-P30. In order to enhance DC vaccine efficacy, we transfected mouse bone marrow (BM)-derived DCs with AdVOVA-P30 and AdVHER2/neu-P30 to generate engineered DCOVA-P30 and DCHER2/neu-P30 vaccines, respectively. We, then, compared CD4(+) and CD8(+) T-cell responses and antitumor immunity derived from DCOVA-P30 and DCHER2/neu-P30 vaccination in wild-type C57BL/6 and transgenic FVBneuN mice, respectively. We demonstrate that engineered DCOVA-P30 vaccine stimulates more efficient CD4(+) and CD8(+) T-cell responses than DCOVA in C57BL/6 mice. Interestingly, the increased DCOVA-P30-induced CTL responses are mainly contributed by enhanced CD4(+) T-cell-stimulated CTL proliferation. We show that DCOVA-P30 vaccine also stimulates more efficient therapeutic immunity against OVA-expressing BL6-10OVA melanoma than DCOVA in C57BL/6 mice. In addition, we demonstrate that DCHER2/neu-P30 vaccine stimulates more efficient CD4(+) and CD8(+) T-cell responses and protective immunity against HER2/neu-expressing Tg1-1 breast cancer than DCHER2/neu in transgenic FVBneuN mice with HER2/neu-specific self-immune tolerance. Therefore, the engineered DCHER

  1. p53 represses autophagy in a cell cycle-dependent fashion.

    PubMed

    Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

    2008-10-01

    Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

  2. Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

    PubMed Central

    2012-01-01

    Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

  3. A facile method to screen inhibitors of protein-protein interactions including MDM2-p53 displayed on T7 phage.

    PubMed

    Ishi, Kazutomo; Sugawara, Fumio

    2008-05-01

    Protein-protein interactions are essential in many biological processes including cell cycle and apoptosis. It is currently of great medical interest to inhibit specific protein-protein interactions in order to treat a variety of disease states. Here, we describe a facile multiwell plate assay method using T7 phage display to screen for candidate inhibitors of protein-protein interactions. Because T7 phage display is an effective method for detecting protein-protein interactions, we aimed to utilize this technique to screen for small-molecule inhibitors that disrupt these types of interaction. We used the well-characterized interaction between p53 and MDM2 and an inhibitor of this interaction, nutlin 3, as a model system to establish a new screening method. Phage particles displaying p53 interacted with GST-MDM2 immobilized on 96-well plates, and the interaction was inhibited by nutlin 3. Multiwell plate assay was then performed using a natural product library, which identified dehydroaltenusin as a candidate inhibitor of the p53-MDM2 interaction. We discuss the potential applications of this novel T7 phage display methodology, which we propose to call 'reverse phage display'.

  4. The Yin and Yang aspects of IL-27 in induction of cancer-specific T-cell responses and immunotherapy.

    PubMed

    Li, Ming-Song; Liu, Zhenzhen; Liu, Jin-Qing; Zhu, Xiaotong; Liu, Zhihao; Bai, Xue-Feng

    2015-01-01

    Accumulating evidences from animal studies have indicated that both endogenous and exogenous IL-27, an IL-12 family of cytokine, can increase antitumor T-cell activities and inhibit tumor growth. IL-27 can modulate Treg responses, and program effector T cells into a unique T-effector stem cell (TSEC) phenotype, which enhances T-cell survival in the tumor microenvironment. However, animal studies also suggest that IL-27 induces molecular pathways such as IL-10, PD-L1 and CD39, which may downregulate tumor-specific T-cell responses. In this review paper, we will discuss the Yin and Yang aspects of IL-27 in the induction of tumor-specific T-cell responses, and the potential impacts of these functions of IL-27 in the design of cancer immunotherapy.

  5. Novel Derivative of Benzofuran Induces Cell Death Mostly by G2/M Cell Cycle Arrest through p53-dependent Pathway but Partially by Inhibition of NF-κB*

    PubMed Central

    Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.

    2010-01-01

    The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557

  6. Heterologous Prime-Boost Regimens with a Recombinant Chimpanzee Adenoviral Vector and Adjuvanted F4 Protein Elicit Polyfunctional HIV-1-Specific T-Cell Responses in Macaques

    PubMed Central

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN (‘A’), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 (‘P’), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques

  7. Hypoxia induces p53 accumulation in the S-phase and accumulation of hypophosphorylated retinoblastoma protein in all cell cycle phases of human melanoma cells.

    PubMed Central

    Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.

    1998-01-01

    Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563

  8. A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

    PubMed

    Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

    2018-05-23

    PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

  9. Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

    PubMed

    Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

    2011-09-27

    Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

  10. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    PubMed

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  11. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    PubMed

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  12. Surgical resection and radiofrequency ablation initiate cancer in cytokeratin-19+- liver cells deficient for p53 and Rb.

    PubMed

    Matondo, Ramadhan B; Toussaint, Mathilda Jm; Govaert, Klaas M; van Vuuren, Luciel D; Nantasanti, Sathidpak; Nijkamp, Maarten W; Pandit, Shusil K; Tooten, Peter Cj; Koster, Mirjam H; Holleman, Kaylee; Schot, Arend; Gu, Guoqiang; Spee, Bart; Roskams, Tania; Rinkes, Inne Borel; Schotanus, Baukje; Kranenburg, Onno; de Bruin, Alain

    2016-08-23

    The long term prognosis of liver cancer patients remains unsatisfactory because of cancer recurrence after surgical interventions, particularly in patients with viral infections. Since hepatitis B and C viral proteins lead to inactivation of the tumor suppressors p53 and Retinoblastoma (Rb), we hypothesize that surgery in the context of p53/Rb inactivation initiate de novo tumorigenesis.We, therefore, generated transgenic mice with hepatocyte and cholangiocyte/liver progenitor cell (LPC)-specific deletion of p53 and Rb, by interbreeding conditional p53/Rb knockout mice with either Albumin-cre or Cytokeratin-19-cre transgenic mice.We show that liver cancer develops at the necrotic injury site after surgical resection or radiofrequency ablation in p53/Rb deficient livers. Cancer initiation occurs as a result of specific migration, expansion and transformation of cytokeratin-19+-liver (CK-19+) cells. At the injury site migrating CK-19+ cells formed small bile ducts and adjacent cells strongly expressed the transforming growth factor β (TGFβ). Isolated cytokeratin-19+ cells deficient for p53/Rb were resistant against hypoxia and TGFβ-mediated growth inhibition. CK-19+ specific deletion of p53/Rb verified that carcinomas at the injury site originates from cholangiocytes or liver progenitor cells.These findings suggest that human liver patients with hepatitis B and C viral infection or with mutations for p53 and Rb are at high risk to develop tumors at the surgical intervention site.

  13. Surgical resection and radiofrequency ablation initiate cancer in cytokeratin-19+- liver cells deficient for p53 and Rb

    PubMed Central

    Govaert, Klaas M; van Vuuren, Luciel D; Nantasanti, Sathidpak; Nijkamp, Maarten W; Pandit, Shusil K; Tooten, Peter CJ; Koster, Mirjam H; Holleman, Kaylee; Schot, Arend; Gu, Guoqiang; Spee, Bart; Roskams, Tania; Rinkes, Inne Borel; Schotanus, Baukje; Kranenburg, Onno; de Bruin, Alain

    2016-01-01

    The long term prognosis of liver cancer patients remains unsatisfactory because of cancer recurrence after surgical interventions, particularly in patients with viral infections. Since hepatitis B and C viral proteins lead to inactivation of the tumor suppressors p53 and Retinoblastoma (Rb), we hypothesize that surgery in the context of p53/Rb inactivation initiate de novo tumorigenesis. We, therefore, generated transgenic mice with hepatocyte and cholangiocyte/liver progenitor cell (LPC)-specific deletion of p53 and Rb, by interbreeding conditional p53/Rb knockout mice with either Albumin-cre or Cytokeratin-19-cre transgenic mice. We show that liver cancer develops at the necrotic injury site after surgical resection or radiofrequency ablation in p53/Rb deficient livers. Cancer initiation occurs as a result of specific migration, expansion and transformation of cytokeratin-19+-liver (CK-19+) cells. At the injury site migrating CK-19+ cells formed small bile ducts and adjacent cells strongly expressed the transforming growth factor β (TGFβ). Isolated cytokeratin-19+ cells deficient for p53/Rb were resistant against hypoxia and TGFβ-mediated growth inhibition. CK-19+ specific deletion of p53/Rb verified that carcinomas at the injury site originates from cholangiocytes or liver progenitor cells. These findings suggest that human liver patients with hepatitis B and C viral infection or with mutations for p53 and Rb are at high risk to develop tumors at the surgical intervention site. PMID:27323406

  14. Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

    PubMed

    Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

    2017-06-01

    p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p < 0.001). The p53 and Bcl-2 immunoreactivity was increased in aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

  15. P53 Gene Mutagenesis in Breast Cancer

    DTIC Science & Technology

    2005-03-01

    the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken

  16. Differential kinetics and specificity of EBV-specific CD4+ and CD8+ T cells during primary infection.

    PubMed

    Precopio, Melissa L; Sullivan, John L; Willard, Courtney; Somasundaran, Mohan; Luzuriaga, Katherine

    2003-03-01

    The generation and maintenance of virus-specific CD4(+) T cells in humans are not well understood. We used short in vitro stimulation assays followed by intracellular cytokine staining to characterize the timing, magnitude, and Ag specificity of CD4(+) T cells over the course of primary EBV infection. Lytic and latent protein-specific CD4(+) T cells were readily detected at presentation with acute infectious mononucleosis and declined rapidly thereafter. Responses to BZLF-1, BMLF-1, and Epstein-Barr nuclear Ag-3A were more commonly detected than responses to Epstein-Barr nuclear Ag-1. Concurrent analyses of BZLF-1-specific CD4(+) and CD8(+) T cells revealed differences in the expansion, specificity, and stability of CD4(+) and CD8(+) T cell-mediated responses over time. Peripheral blood EBV load directly correlated with the frequency of EBV-specific CD4(+) T cell responses at presentation and over time, suggesting that EBV-specific CD4(+) T cell responses are Ag-driven.

  17. Mechanical cell competition kills cells via induction of lethal p53 levels

    PubMed Central

    Wagstaff, Laura; Goschorska, Maja; Kozyrska, Kasia; Duclos, Guillaume; Kucinski, Iwo; Chessel, Anatole; Hampton-O'Neil, Lea; Bradshaw, Charles R.; Allen, George E.; Rawlins, Emma L.; Silberzan, Pascal; Carazo Salas, Rafael E.; Piddini, Eugenia

    2016-01-01

    Cell competition is a quality control mechanism that eliminates unfit cells. How cells compete is poorly understood, but it is generally accepted that molecular exchange between cells signals elimination of unfit cells. Here we report an orthogonal mechanism of cell competition, whereby cells compete through mechanical insults. We show that MDCK cells silenced for the polarity gene scribble (scribKD) are hypersensitive to compaction, that interaction with wild-type cells causes their compaction and that crowding is sufficient for scribKD cell elimination. Importantly, we show that elevation of the tumour suppressor p53 is necessary and sufficient for crowding hypersensitivity. Compaction, via activation of Rho-associated kinase (ROCK) and the stress kinase p38, leads to further p53 elevation, causing cell death. Thus, in addition to molecules, cells use mechanical means to compete. Given the involvement of p53, compaction hypersensitivity may be widespread among damaged cells and offers an additional route to eliminate unfit cells. PMID:27109213

  18. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  19. Determinants of public T cell responses.

    PubMed

    Li, Hanjie; Ye, Congting; Ji, Guoli; Han, Jiahuai

    2012-01-01

    Historically, sharing T cell receptors (TCRs) between individuals has been speculated to be impossible, considering the dramatic discrepancy between the potential enormity of the TCR repertoire and the limited number of T cells generated in each individual. However, public T cell response, in which multiple individuals share identical TCRs in responding to a same antigenic epitope, has been extensively observed in a variety of immune responses across many species. Public T cell responses enable individuals within a population to generate similar antigen-specific TCRs against certain ubiquitous pathogens, leading to favorable biological outcomes. However, the relatively concentrated feature of TCR repertoire may limit T cell response in a population to some other pathogens. It could be a great benefit for human health if public T cell responses can be manipulated. Therefore, the mechanistic insight of public TCR generation is important to know. Recently, high-throughput DNA sequencing has revolutionized the study of immune receptor repertoires, which allows a much better understanding of the factors that determine the overlap of TCR repertoire among individuals. Here, we summarize the current knowledge on public T-cell response and discuss future challenges in this field.

  20. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region.

  1. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

  2. T follicular helper and T follicular regulatory cells have different TCR specificity

    PubMed Central

    Maceiras, Ana Raquel; Almeida, Silvia Cristina Paiva; Mariotti-Ferrandiz, Encarnita; Chaara, Wahiba; Jebbawi, Fadi; Six, Adrien; Hori, Shohei; Klatzmann, David; Faro, Jose; Graca, Luis

    2017-01-01

    Immunization leads to the formation of germinal centres (GCs) that contain both T follicular helper (Tfh) and T follicular regulatory (Tfr) cells. Whether T-cell receptor (TCR) specificity defines the differential functions of Tfh and Tfr cells is unclear. Here we show that antigen-specific T cells after immunization are preferentially recruited to the GC to become Tfh cells, but not Tfr cells. Tfh cells, but not Tfr cells, also proliferate efficiently on restimulation with the same immunizing antigen in vitro. Ex vivo TCR repertoire analysis shows that immunization induces oligoclonal expansion of Tfh cells. By contrast, the Tfr pool has a TCR repertoire that more closely resembles that of regulatory T (Treg) cells. Our data thus indicate that the GC Tfh and Tfr pools are generated from distinct TCR repertoires, with Tfh cells expressing antigen-responsive TCRs to promote antibody responses, and Tfr cells expressing potentially autoreactive TCRs to suppress autoimmunity. PMID:28429709

  3. Rapamycin regulates the proliferation of Huh7, a hepatocellular carcinoma cell line, by up-regulating p53 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwon, Sora; Jeon, Ji-Sook; Ahn, Curie

    Rapamycin, a specific inhibitor of mTOR used extensively as an immunosuppressant, has been expanded recently to cancer therapy, because the mTOR signal is known to be up-regulated in various cancer cells including hepatocellular carcinoma (HCC) cells. In spite of extensive efforts to employ mTOR inhibitors as anti-HCC therapy, they have not yet been approved by the FDA. Because of the heterogeneity and complexity of molecular signaling in HCC, suitable biomarkers should be identified or discovered to improve clinical efficacy of mTOR-specific inhibitors to HCC cells. In this study, the effect of rapamycin was investigated on two different HCC cell lines,more » Huh7 cells and HepG2 cells. Rapamycin was found to inhibit the proliferation of Huh7 cells but not of HepG2 cells. Moreover, it was found that rapamycin can up-regulate p53 at the protein level, but not affect its transcript. To understand the critical role of p53 in the rapamycin effect, knock-down experiments were performed using small-interfering RNAs (siRNAs). The anti-proliferative effect of rapamycin on Huh7 cells clearly disappeared after blocking p53 production with siRNA, which indicates that p53 is a critical factor in the anti-proliferative effect of rapamycin in HCC cells. The over-expression system of p53 was also employed to mimic the effect of rapamycin and found that cell proliferation was clearly down-regulated by p53 over-expression. Finally, we found that the extracellular signal-regulated kinase 1/2 (ERK1/2) signal was regulated by p53 whose expression was induced by rapamycin. Overall, this study demonstrates that rapamycin inhibited the proliferation of Huh7 cells by up-regulating the expression of p53 and down-regulating the ERK1/2 signal, indicating that p53 is a useful biomarker for anti-cancer therapy using the specific inhibitor of mTOR signal, rapamycin, against hepatocellular carcinoma cells. - Highlights: • Rapamycin inhibits the proliferation of hepatocellular carcinoma

  4. Diagnostic usefulness of dynamic changes of CMV-specific T-cell responses in predicting CMV infections in HCT recipients.

    PubMed

    Jung, Jiwon; Lee, Hyun-Jung; Kim, Sun-Mi; Kang, Young-Ah; Lee, Young-Shin; Chong, Yong Pil; Sung, Heungsup; Lee, Sang-Oh; Choi, Sang-Ho; Kim, Yang Soo; Woo, Jun Hee; Lee, Jung-Hee; Lee, Je-Hwan; Lee, Kyoo-Hyung; Kim, Sung-Han

    2017-02-01

    CMV-specific cell mediated immune responses before and after hematopoietic stem cell transplantation (HCT) can categorize patients as at high or low risk of CMV development. We evaluated the usefulness of the CMV-specific T-cell ELISPOT assay for predicting the development of CMV infections after HCT in recipients with donor-positive and recipient-positive CMV serology (D+/R+ ). CMV pp65 and IE1-specific ELISPOT assays were performed before HCT (D0), and at 30 (D30) and 90 (D90) days after HCT. Of the 84 HCT recipients with D+/R+, 42 (50%) developed≥1 episode of CMV infection. Thirty-nine (64%) of 61 patients with Δ(D30-D0) pp65<42 developed CMV infections compared with 3 (14%) of 21 patients with Δ(D30-D0) pp65≥42 (P<0.001). Twenty-three (74%) of 31 patients with Δ(D30-D0) IE1<-4 developed CMV infections compared with 19 (37%) of 51 patients with Δ(D30-D0) IE1≥-4 (P=0.001). pp65 Δ(D30-D0) ≥42 had 93% sensitivity for ruling out subsequent CMV infection, and pp65 Δ(D30-D0)<42 followed by Δ(D30-D0) IE1<-4 had 100% specificity for ruling in the subsequent CMV infection. In addition, 10 (53%) of 19 patients with Δ(D90-D30) pp65<23 had relapsing CMV infections, compared with 3 (15%) of 20 patients with Δ(D90-D30) pp65≥23 (P=0.02). The sensitivity and specificity of Δ(D90-D30) pp65 were 77% (95% CI 50-92) and 65% (95% CI, 46-81). Dynamic change in the CMV-specific ELISPOT assay before versus after HCT appears to predict the subsequent development of CMV infection and relapsing CMV infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    PubMed

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  6. p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

    PubMed Central

    Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

    2011-01-01

    p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

  7. Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.

    PubMed

    Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias

    2012-03-01

    To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.

  8. Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

    PubMed Central

    Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

    2017-01-01

    Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

  9. Etoposide radiosensitizes p53-defective cholangiocarcinoma cell lines independent of their G2 checkpoint efficacies

    PubMed Central

    Hematulin, Arunee; Meethang, Sutiwan; Utapom, Kitsana; Wongkham, Sopit; Sagan, Daniel

    2018-01-01

    Radiotherapy has been accounted as the most comprehensive cancer treatment modality over the past few decades. However, failure of this treatment modality occurs in several malignancies due to the resistance of cancer cells to radiation. It was previously reported by the present authors that defective cell cycle checkpoints could be used as biomarkers for predicting the responsiveness to radiation in individual patients with cholangiocarcinoma (CCA). However, identification of functional defective cell cycle checkpoints from cells from a patient's tissues is cumbersome and not applicable in the clinic. The present study evaluated the radiosensitization potential of etoposide in p53-defective CCA KKU-M055 and KKU-M214 cell lines. Treatment with etoposide enhanced the responsiveness of two p53-defective CCA cell lines to radiation independent of G2 checkpoint function. In addition, etoposide treatment increased radiation-induced cell death without altering the dominant mode of cell death of the two cell lines. These findings indicate that etoposide could be used as a radiation sensitizer for p53-defective tumors, independent of the function of G2 checkpoint. PMID:29541168

  10. BK Polyomavirus-Specific 9mer CD8 T Cell Responses Correlate With Clearance of BK Viremia in Kidney Transplant Recipients: First Report From the Swiss Transplant Cohort Study.

    PubMed

    Leboeuf, C; Wilk, S; Achermann, R; Binet, I; Golshayan, D; Hadaya, K; Hirzel, C; Hoffmann, M; Huynh-Do, U; Koller, M T; Manuel, O; Mueller, N J; Mueller, T F; Schaub, S; van Delden, C; Weissbach, F H; Hirsch, H H

    2017-10-01

    BK polyomavirus (BKPyV) causes premature kidney transplant (KT) failure in 1-15% of patients. Because antivirals are lacking, most programs screen for BKPyV-viremia and, if positive, reduce immunosuppression. To evaluate the relationship of viremia and BKPyV-specific immunity, we examined prospectively cryopreserved plasma and peripheral blood mononuclear cells at the time of transplantation (T0) and at 6 mo (T6) and 12 mo (T12) after transplant from 28 viremic KT patients and 68 nonviremic controls matched for the transplantation period. BKPyV IgG seroprevalence was comparable between cases (89.3%) and controls (91.2%; p = 0.8635), but cases had lower antibody levels (p = 0.022) at T0. Antibody levels increased at T6 and T12 but were not correlated with viremia clearance. BKPyV-specific T cell responses to pools of overlapping 15mers (15mer peptide pool [15mP]) or immunodominant CD8 9mers (9mer peptide pool [9mP]) from the early viral gene region were not different between cases and controls at T0; however, clearance of viremia was associated with stronger 9mP responses at T6 (p = 0.042) and T12 (p = 0.048), whereas 15mP responses were not informative (T6 p = 0.359; T12 p = 0.856). BKPyV-specific T cells could be expanded in vitro from all patients after transplant, permitting identification of 78 immunodominant 9mer epitopes including 50 new ones across different HLA class I. Thus, 9mP-responses may be a novel marker of reconstituting CD8 T cell function that warrants further study as a complement of plasma BKPyV loads for guiding immunosuppression reduction. © 2017 The American Society of Transplantation and the American Society of Transplant Surgeons.

  11. HIV skews the lineage-defining transcriptional profile of Mycobacterium tuberculosis-specific CD4+ T cells

    PubMed Central

    Riou, Catherine; Strickland, Natalie; Soares, Andreia P.; Corleis, Bjorn; Kwon, Douglas; Wherry, E. John; Wilkinson, Robert J.; Burgers, Wendy A.

    2016-01-01

    HIV-infected persons are at greater risk of developing tuberculosis (TB) even before profound CD4 loss occurs, suggesting that HIV alters CD4+T cell functions capable of containing bacterial replication. An effective immune response to Mycobacterium tuberculosis likely relies on the development of a balanced CD4 response, where distinct CD4+T helper subsets act in synergy to control the infection. To define the diversity of Mtb-specific CD4+Th subsets and determine whether HIV infection impacts such responses, the expression of lineage-defining transcription factors T-bet, Gata3, RORγt and Foxp3 was measured in Mtb-specific CD4+T cells in HIV-uninfected (n=20) and HIV-infected individuals (n=20) with latent TB infection. Our results show that upon 5 day restimulation in vitro, Mtb-specific CD4+T cells from healthy individuals have the ability to exhibit a broad spectrum of T helper subsets, defined by specific patterns of transcription factor co-expression. These transcription factor profiles were skewed in HIV-infected individuals where the proportion of T-bethighFoxp3+ Mtb-specific CD4+T cells was significantly decreased (p=0.002) compared to HIV-uninfected individuals, a change that correlated inversely with HIV viral load (p=0.0007) and plasma TNF-α (p=0.027). Our data demonstrate an important balance in T helper subset diversity defined by lineage-defining transcription factor co-expression profiles that is disrupted by HIV infection and suggest a role for HIV in impairing TB immunity by altering the equilibrium of Mtb-specific CD4+T helper subsets. PMID:26927799

  12. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

    PubMed Central

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

  13. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    PubMed

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  14. HIV-specific antibodies but not t-cell responses are associated with protection in seronegative partners of HIV-1-infected individuals in Cambodia.

    PubMed

    Nguyen, Marie; Pean, Polidy; Lopalco, Lucia; Nouhin, Janin; Phoung, Viseth; Ly, Nary; Vermisse, Pierre; Henin, Yvette; Barré-Sinoussi, Françoise; Burastero, Samuele E; Reynes, Jean-Marc; Carcelain, Guislaine; Pancino, Gianfranco

    2006-08-01

    To study biological factors related to protection against HIV-1 infection in Cambodia, we recruited 48 partners of HIV-1-infected patients who remained uninfected (exposed uninfected individuals, EUs) despite unprotected sexual intercourse for more than 1 year and 49 unexposed controls (UCs). HIV-1-specific antibodies (IgA anti-gp41 and IgG anti-CD4-gp120 complex), T-cell responses, and cellular factors that may be involved in protection (peripheral blood mononuclear cell [PBMC] resistance to HIV-1 infection and beta-chemokine production) were evaluated. Anti-HIV-1 antibodies were higher in EUs than those in UCs (P = 0.01 and P = 0.04 for anti-gp41 and anti-CD4-gp120, respectively). We observed a decreased susceptibility to a primary Cambodian isolate, HIV-1KH019, in EU PBMCs as compared with UC PBMCs (P = 0.03). A weak T-cell response to one pool of HIV-1 Gag peptides was found by ELISpot in 1 of 19 EUs. Whereas T-cell specific immunity was not associated to protection, our results suggest that HIV-specific humoral immunity and reduced cell susceptibility to infection may contribute to protection against HIV-1 infection in Cambodian EUs.

  15. A phase 1/2 study combining gemcitabine, Pegintron and p53 SLP vaccine in patients with platinum-resistant ovarian cancer.

    PubMed

    Dijkgraaf, Eveline M; Santegoets, Saskia J A M; Reyners, An K L; Goedemans, Renske; Nijman, Hans W; van Poelgeest, Mariëtte I E; van Erkel, Arien R; Smit, Vincent T H B M; Daemen, Toos A H H; van der Hoeven, Jacobus J M; Melief, Cornelis J M; Welters, Marij J P; Kroep, Judith R; van der Burg, Sjoerd H

    2015-10-13

    Preclinical tumor models show that chemotherapy has immune modulatory properties which can be exploited in the context of immunotherapy. The purpose of this study was to determine the feasibility and immunogenicity of combinations of such an immunomodulatory chemotherapeutic agent with immunotherapy, p53 synthetic long peptide (SLP) vaccine and Pegintron (IFN-α) in patients with platinum-resistant p53-positive epithelial ovarian cancer (EOC). This is a phase 1/2 trial in which patients sequential 6 cycles of gemcitabine (1000 mg/kg2 iv; n = 3), gemcitabine with Pegintron before and after the first gemcitabine cycle (Pegintron 1 μg/kg sc; n = 6), and gemcitabine and Pegintron combined with p53 SLP vaccine (0.3 mg/peptide, 9 peptides; n = 6). At baseline, 22 days after the 2nd and 6th cycle, blood was collected for immunomonitoring. Toxicity, CA-125, and radiologic response were evaluated after 3 and 6 cycles of chemotherapy. None of the patients enrolled experienced dose-limiting toxicity. Predominant grade 3/4 toxicities were nausea/vomiting and dyspnea. Grade 1/2 toxicities consisted of fatigue (78%) and Pegintron-related flu-like symptoms (72%). Gemcitabine reduced myeloid-derived suppressor cells (p = 0.0005) and increased immune-supportive M1 macrophages (p = 0.04). Combination of gemcitabine and Pegintron stimulated higher frequencies of circulating proliferating CD4+ and CD8+ T-cells but not regulatory T-cells. All vaccinated patients showed strong vaccine-induced p53-specific T-cell responses. Combination of gemcitabine, the immune modulator Pegintron and therapeutic peptide vaccination is a viable approach in the development of combined chemo-immunotherapeutic regimens to treat cancer.

  16. Influence of p53 status on the effects of boron neutron capture therapy in glioblastoma.

    PubMed

    Seki, Keiko; Kinashi, Yuko; Takahashi, Sentaro

    2015-01-01

    The tumor suppressor gene p53 is mutated in glioblastoma. We studied the relationship between the p53 gene and the biological effects of boron neutron capture therapy (BNCT). The human glioblastoma cells; A172, expressing wild-type p53, and T98G, with mutant p53, were irradiated by the Kyoto University Research Reactor (KUR). The biological effects after neutron irradiation were evaluated by the cell killing effect, 53BP1 foci assay and apoptosis induction. The survival-fraction data revealed that A172 was more radiosensitive than T98G, but the difference was reduced when boronophenylalanine (BPA) was present. Both cell lines exhibited similar numbers of foci, suggesting that the initial levels of DNA damage did not depend on p53 function. Detection of apoptosis revealed a lower rate of apoptosis in the T98G. BNCT causes cell death in glioblastoma cells, regardless of p53 mutation status. In T98G cells, cell killing and apoptosis occurred effectively following BNCT. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Detection of p53 mutations in proliferating vascular cells in glioblastoma multiforme.

    PubMed

    Kawasoe, Takuma; Takeshima, Hideo; Yamashita, Shinji; Mizuguchi, Sohei; Fukushima, Tsuyoshi; Yokogami, Kiyotaka; Yamasaki, Kouji

    2015-02-01

    Glioblastoma multiforme (GBM), one of the most aggressive tumors in humans, is highly angiogenic. However, treatment with the angiogenesis inhibitor bevacizumab has not significantly prolonged overall patient survival times. GBM resistance to angiogenesis inhibitors is attributed to multiple interacting mechanisms. Although mesenchymal transition via glioma stem-like cells has attracted attention, it is considered a poor biomarker. There is no simple method for differentiating tumor-derived and reactive vascular cells from normal cells. The authors attempted to detect the mesenchymal transition of tumor cells by means of p53 and isocitrate dehydrogenase 1 (IDH1) immunohistochemistry. Using antibody against p53 and IDH1 R132H, the authors immunohistochemically analyzed GBM tissue from patients who had undergone surgery at the University of Miyazaki Hospital during August 2005-December 2011. They focused on microvascular proliferation with a p53-positive ratio exceeding 50%. They compared TP53 mutations in original tumor tissues and in p53-positive and p53-negative microvascular proliferation cells collected by laser microdissection. Among 61 enrolled GBM patients, the first screening step (immunostaining) identified 46 GBMs as p53 positive, 3 of which manifested areas of prominent p53-positive microvascular proliferation (>50%). Histologically, areas of p53-positive microvascular proliferation tended to be clustered, and they coexisted with areas of p53-negative microvascular proliferation. Both types of microvascular proliferation cells were clearly separated from original tumor cells by glial fibrillary acidic protein, epidermal growth factor receptor, and low-/high-molecular-weight cytokeratin. DNA sequencing analysis disclosed that p53-positive microvascular proliferation cells exhibited TP53 mutations identical to those observed in the original tumor; p53-negative microvascular proliferation cells contained a normal allele. Although immunostaining indicated

  18. The expanding universe of p53 targets.

    PubMed

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  19. Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

    PubMed

    Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

    1998-01-01

    Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

  20. Battle against cancer: an everlasting saga of p53.

    PubMed

    Hao, Qian; Cho, William C

    2014-12-01

    Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  1. Antigen-Specific T-Cell Activation Independently of the MHC: Chimeric Antigen Receptor-Redirected T Cells

    PubMed Central

    Chmielewski, Markus; Hombach, Andreas A.; Abken, Hinrich

    2013-01-01

    Adoptive T-cell therapy has recently shown promise in initiating a lasting anti-tumor response with spectacular therapeutic success in some cases. Specific T-cell therapy, however, is limited since a number of cancer cells are not recognized by T cells due to various mechanisms including the limited availability of tumor-specific T cells and deficiencies in antigen processing or major histocompatibility complex (MHC) expression of cancer cells. To make adoptive cell therapy applicable for the broad variety of cancer entities, patient’s T cells are engineered ex vivo with pre-defined specificity by a recombinant chimeric antigen receptor (CAR) which consists in the extracellular part of an antibody-derived domain for binding with a “tumor-associated antigen” and in the intracellular part of a T-cell receptor (TCR)-derived signaling moiety for T-cell activation. The specificity of CAR-mediated T-cell recognition is defined by the antibody domain, is independent of MHC presentation and can be extended to any target for which an antibody is available. We discuss the advantages and limitations of MHC-independent T-cell targeting by an engineered CAR in comparison to TCR modified T cells and the impact of the CAR activation threshold on redirected T-cell activation. Finally we review most significant progress recently made in early stage clinical trials to treat cancer. PMID:24273543

  2. Antigen-Specific T-Cell Activation Independently of the MHC: Chimeric Antigen Receptor-Redirected T Cells.

    PubMed

    Chmielewski, Markus; Hombach, Andreas A; Abken, Hinrich

    2013-01-01

    Adoptive T-cell therapy has recently shown promise in initiating a lasting anti-tumor response with spectacular therapeutic success in some cases. Specific T-cell therapy, however, is limited since a number of cancer cells are not recognized by T cells due to various mechanisms including the limited availability of tumor-specific T cells and deficiencies in antigen processing or major histocompatibility complex (MHC) expression of cancer cells. To make adoptive cell therapy applicable for the broad variety of cancer entities, patient's T cells are engineered ex vivo with pre-defined specificity by a recombinant chimeric antigen receptor (CAR) which consists in the extracellular part of an antibody-derived domain for binding with a "tumor-associated antigen" and in the intracellular part of a T-cell receptor (TCR)-derived signaling moiety for T-cell activation. The specificity of CAR-mediated T-cell recognition is defined by the antibody domain, is independent of MHC presentation and can be extended to any target for which an antibody is available. We discuss the advantages and limitations of MHC-independent T-cell targeting by an engineered CAR in comparison to TCR modified T cells and the impact of the CAR activation threshold on redirected T-cell activation. Finally we review most significant progress recently made in early stage clinical trials to treat cancer.

  3. Early Gag Immunodominance of the HIV-Specific T-Cell Response during Acute/Early Infection Is Associated with Higher CD8+ T-Cell Antiviral Activity and Correlates with Preservation of the CD4+ T-Cell Compartment

    PubMed Central

    Ghiglione, Yanina; Falivene, Juliana; Socias, María Eugenia; Laufer, Natalia; Coloccini, Romina Soledad; Rodriguez, Ana María; Ruiz, María Julia; Pando, María Ángeles; Giavedoni, Luis David; Cahn, Pedro; Sued, Omar; Salomon, Horacio; Gherardi, María Magdalena

    2013-01-01

    The important role of the CD8+ T-cell response on HIV control is well established. Moreover, the acute phase of infection represents a proper scenario to delineate the antiviral cellular functions that best correlate with control. Here, multiple functional aspects (specificity, ex vivo viral inhibitory activity [VIA] and polyfunctionality) of the HIV-specific CD8+ T-cell subset arising early after infection, and their association with disease progression markers, were examined. Blood samples from 44 subjects recruited within 6 months from infection (primary HIV infection [PHI] group), 16 chronically infected subjects, 11 elite controllers (EC), and 10 healthy donors were obtained. Results indicated that, although Nef dominated the anti-HIV response during acute/early infection, a higher proportion of early anti-Gag T cells correlated with delayed progression. Polyfunctional HIV-specific CD8+ T cells were detected at early time points but did not associate with virus control. Conversely, higher CD4+ T-cell set points were observed in PHI subjects with higher HIV-specific CD8+ T-cell VIA at baseline. Importantly, VIA levels correlated with the magnitude of the anti-Gag cellular response. The advantage of Gag-specific cells may result from their enhanced ability to mediate lysis of infected cells (evidenced by a higher capacity to degranulate and to mediate VIA) and to simultaneously produce IFN-γ. Finally, Gag immunodominance was associated with elevated plasma levels of interleukin 2 (IL-2) and macrophage inflammatory protein 1β (MIP-1β). All together, this study underscores the importance of CD8+ T-cell specificity in the improved control of disease progression, which was related to the capacity of Gag-specific cells to mediate both lytic and nonlytic antiviral mechanisms at early time points postinfection. PMID:23616666

  4. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  5. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed Central

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  6. Collaboration between tumor-specific CD4+ T cells and B cells in anti-cancer immunity.

    PubMed

    Guy, Thomas V; Terry, Alexandra M; Bolton, Holly A; Hancock, David G; Zhu, Erhua; Brink, Robert; McGuire, Helen M; Shklovskaya, Elena; Fazekas de St. Groth, Barbara

    2016-05-24

    The role of B cells and antibodies in anti-tumor immunity is controversial, with both positive and negative effects reported in animal models and clinical studies. We developed a murine B16.F10 melanoma model to study the effects of collaboration between tumor-specific CD4+ T cells and B cells on tumor control. By incorporating T cell receptor transgenic T cells and B cell receptor isotype switching B cells, we were able to track the responses of tumor-reactive T and B cells and the development of anti-tumor antibodies in vivo. In the presence of tumor-specific B cells, the number of tumor-reactive CD4+ T cells was reduced in lymphoid tissues and the tumor itself, and this correlated with poor tumor control. B cells had little effect on the Th1 bias of the CD4+ T cell response, and the number of induced FoxP3+ regulatory cells (iTregs) generated from within the original naive CD4+ T cell inoculum was unrelated to the degree of B cell expansion. In response to CD4+ T cell help, B cells produced a range of isotype-switched anti-tumor antibodies, principally IgG1, IgG2a/c and IgG2b. In the absence of CD4+ T cells, B cells responded to agonistic anti-CD40 administration by switching to production of IgG2a/c and, to a lesser extent, IgG1, IgG3, IgA and IgE, which reduced the number of lung metastases after i.v. tumor inoculation but had no effect on the growth of subcutaneous tumors.

  7. Evodiamine selectively targets cancer stem-like cells through the p53-p21-Rb pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Seula; Woo, Jong Kyu; Jung, Yuchae

    In spite of the recent improvements, the resistance to chemotherapy/radiotherapy followed by relapse is the main hurdle for the successful treatment of breast cancer, a leading cause of death in women. A small population of breast cancer cells that have stem-like characteristics (cancer stem-like cells; CSLC) may contribute to this resistance and relapse. Here, we report on a component of a traditional Chinese medicine, evodiamine, which selectively targets CSLC of breast cancer cell lines MCF7 and MDAMB 231 at a concentration that does show a little or no cytotoxic effect on bulk cancer cells. While evodiamine caused the accumulation of bulkmore » cancer cells at the G2/M phase, it did not hold CSLC in a specific cell cycle phase but instead, selectively killed CSLC. This was not due to the culture of CSLC in suspension or without FBS. A proteomic analysis and western blotting revealed that evodiamine changed the expression of cell cycle regulating molecules more efficiently in CSLC cells than in bulk cancer cells. Surprisingly, evodiamine selectively activated p53 and p21 and decreased inactive Rb, the master molecules in G1/S checkpoint. These data collectively suggest a novel mechanism involving CSLC-specific targeting by evodiamine and its possible use to the therapy of breast cancer. - Highlights: • Evodiamine selectively kills breast cancer stem like cells at G1 phase. • Evodiamine utilizes different mechanism of cell cycle modulation in CSLC and in bulk cancer cells. • Evodiamine activate the p53, p21 and Rb pathway.« less

  8. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    PubMed

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  9. Characterization of p-phenylenediamine-albumin binding sites and T-cell responses to hapten-modified protein.

    PubMed

    Jenkinson, Claire; Jenkins, Rosalind E; Aleksic, Maja; Pirmohamed, Munir; Naisbitt, Dean J; Park, B Kevin

    2010-03-01

    Exposure to p-phenylenediamine (PPD) is associated with the development of T-cell-mediated allergic contact dermatitis. The purpose of this study was to define the nature of the interaction of PPD with the protein and the antigenic determinant that stimulates T cells. Mass spectrometry was employed to show that PPD oxidation products bind irreversibly to cysteine (Cys, position 34) in human serum albumin (HSA). A modified tryptic peptide was characterized with an increase in mass of 106 Da, corresponding to the addition of PPD and not to the secondary products of self conjugation. Lymphocytes from 10 PPD-allergic patients, but not tolerant/naive individuals, were stimulated with PPD and PPD-modified HSA. A total of 70 PPD-specific and 10 PPD-HSA-specific CD4+, CD8+, and CD4+CD8+, Th2-secreting T-cell clones were generated from three allergic patients. In total, 40 clones were stimulated with both PPD and PPD-modified HSA. PPD-modified HSA triggered T-cell responses through a classical hapten mechanism involving processing. Presentation of PPD to several clones was dependent on protein complex formation (42 out of 48) and processing (32 out of 68); however, 12% of clones were triggered with PPD directly. These data identify Cys as the single target for PPD-HSA binding, and show that PPD protein adducts are antigenic determinants in patients with contact dermatitis.

  10. Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.

    PubMed

    Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko

    2017-11-30

    Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.

  11. Using Antigen-Specific B Cells to Combine Antibody and T Cell-Based Cancer Immunotherapy.

    PubMed

    Wennhold, Kerstin; Thelen, Martin; Schlößer, Hans Anton; Haustein, Natalie; Reuter, Sabrina; Garcia-Marquez, Maria; Lechner, Axel; Kobold, Sebastian; Rataj, Felicitas; Utermöhlen, Olaf; Chakupurakal, Geothy; Theurich, Sebastian; Hallek, Michael; Abken, Hinrich; Shimabukuro-Vornhagen, Alexander; von Bergwelt-Baildon, Michael

    2017-09-01

    Cancer immunotherapy by therapeutic activation of T cells has demonstrated clinical potential. Approaches include checkpoint inhibitors and chimeric antigen receptor T cells. Here, we report the development of an alternative strategy for cellular immunotherapy that combines induction of a tumor-directed T-cell response and antibody secretion without the need for genetic engineering. CD40 ligand stimulation of murine tumor antigen-specific B cells, isolated by antigen-biotin tetramers, resulted in the development of an antigen-presenting phenotype and the induction of a tumor antigen-specific T-cell response. Differentiation of antigen-specific B cells into antibody-secreting plasma cells was achieved by stimulation with IL21, IL4, anti-CD40, and the specific antigen. Combined treatment of tumor-bearing mice with antigen-specific CD40-activated B cells and antigen-specific plasma cells induced a therapeutic antitumor immune response resulting in remission of established tumors. Human CEA or NY-ESO-1-specific B cells were detected in tumor-draining lymph nodes and were able to induce antigen-specific T-cell responses in vitro, indicating that this approach could be translated into clinical applications. Our results describe a technique for the exploitation of B-cell effector functions and provide the rationale for their use in combinatorial cancer immunotherapy. Cancer Immunol Res; 5(9); 730-43. ©2017 AACR . ©2017 American Association for Cancer Research.

  12. Characteristics of Prevotella intermedia-specific CD4+ T cell clones from peripheral blood of a chronic adult periodontitis patient

    PubMed Central

    Wassenaar, A; Reinhardus, C; Abraham-Inpijn, L; Snijders, A; Kievits, F

    1998-01-01

    Periodontitis is a chronic destructive inflammatory disease associated with periodontopathic bacteria. In addition, autoantigens such as collagen and heat shock proteins (hsp) have been suggested to play a role. Established periodontal lesions are characterized by dense infiltrations of immune cells such as cytokine-producing CD4+ and CD8+ T cells. CD4+ T cells specific for Prevotella intermedia can be isolated from lesional gingiva, suggesting an active role for CD4+ T cells in the response to this bacterium. We therefore investigated the characteristics of a panel of 13 P. intermedia-specific CD4+ T cells generated from the peripheral blood of a patient with chronic adult periodontitis. All 13 P. intermedia-specific CD4+ T cells recognized the antigens in the context of HLA-DR. The T cell clones were mainly classified as Th0, producing comparable amounts of interferon-gamma (IFN-γ) and IL-4, and Th2, producing high amounts of IL-4 and almost no IFN-γ. None of the P. intermedia-specific T cell clones recognized antigens of the periodontopathic bacteria Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis and of the autoantigens collagen and hsp. The reactivity profile of the T cell clones to size-fractionated cell envelope antigens of P. intermedia indicated that P. intermedia-specific CD4+ T cell clones recognize probably five different antigen specificities in the context of the MHC class II molecules, DR7 or DR15. These results suggest that a broad panel of cell-associated protein antigens play a role in the induction of P. intermedia-specific CD4+ T cell response. PMID:9697992

  13. BK virus-specific T cells for use in cellular therapy show specificity to multiple antigens and polyfunctional cytokine responses.

    PubMed

    Blyth, Emily; Clancy, Leighton; Simms, Renee; Gaundar, Shivashni; O'Connell, Philip; Micklethwaite, Kenneth; Gottlieb, David J

    2011-11-27

    BK virus (BKV) infection causes hemorrhagic cystitis posthemopoietic stem-cell transplant and graft loss in renal transplant recipients. Reactivation occurs in up to 60% of patients in both groups. Treatment-related cellular immunosuppression is a major contributor to the development of BKV-related disease, but the targets of the immune response are not well characterized. Immunotherapy by adoptive transfer of cellular effectors has been shown to be effective in controlling and preventing some virus-related diseases in transplant recipients, particularly Epstein-Barr virus and cytomegalovirus. Infusion of BKV-specific T cells may potentially reconstitute functional BKV immunity and reduce clinical complications of BKV infection. BKV-specific T cells for clinical use in adoptive immunotherapy were generated using monocyte-derived dendritic cells pulsed with overlapping peptide mixes spanning the five BKV proteins VP1, VP2, VP3, large T antigen, and small T antigen. Phenotypic and functional characteristics of the cells were investigated as well as their antigen specificity. Expanded CD4(+) and CD8(+) cells responded to restimulation with BKV peptides principally from VP1, large T, or small T antigens; produced multiple cytokines; and showed cytotoxic activity against antigen-coated targets. Possible clinical uses for BKV-specific T cells generated using this method include immune reconstitution posthemopoietic stem-cell transplantation or prophylaxis and treatment of immune deficiency in renal transplant recipients, fulfilling the need for effective therapy for BKV-related hemorrhagic cystitis and renal dysfunction.

  14. INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.

    PubMed

    2007-01-01

    Introgen and its wholly owned European subsidiary Gendux AB are developing an adenoviral p53 gene therapy as a treatment for cancer in the US and Europe, respectively. Phase III trials in patients with head and neck cancer are ongoing, and a number of clinical trials in other cancer indications have been completed. INGN 201 is being reviewed by the EMEA for approval in Li-Fraumeni syndrome (LFS) under the provisions of exceptional circumstance; the therapy is available on a compassionate use basis to eligible LFS cancer patients under a protocol authorised by the US FDA. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. The p53 protein is one of the most intricate elements in the apoptotic signalling cascade, and a mutation in the gene encoding it is believed to result in a decreased ability of a cell to apoptose. Thus replacing this gene via adenovirally-mediated p53 gene therapy is hoped to result in increased apoptosis where it is administered.INGN 201 is available for licensing, although Introgen favours retaining partial or full rights to the therapy in the US. Introgen entered into a license agreement with The University of Texas System and MD Anderson Cancer Center in 1994. The technologies licenced include p53 and fus1 (INGN 401). The collaboration has yielded exclusive patent and licensing rights to numerous technologies. Introgen entered into a collaboration with Rhône-Poulenc Rorer Pharmaceuticals (now sanofi-aventis) to develop therapeutics based on p53 inhibition in October 1994. However, in June 2001 this relationship was restructured and Introgen assumed responsibility for the worldwide development of all p53 products including INGN 201, and acquired all marketing and commercialisation rights with respect to those products. Introgen initiated two phase III trials in head and neck cancer (in June 2000 and May 2001) at about 80 sites in the US, Canada and Europe

  15. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    PubMed Central

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  16. T cell cytokine responses to stimulation with Ureaplasma parvum in pregnancy.

    PubMed

    Friedland, Yael D; Lee-Pullen, Tracey F; Nathan, Elizabeth A; Watts, Rory; Keelan, Jeffrey A; Payne, Matthew S; Ireland, Demelza J

    2016-08-01

    Ureaplasma spp. are a common vaginal microorganism causally linked to inflammation-driven preterm birth (PTB). The nature of the immune response to Ureaplasma spp. may influence PTB risk. This study sought to define maternal T cell cytokine responses to in vitro stimulation with Ureaplasma parvum serovar 3 (UpSV3) in vaginally colonised (UP+) and non-colonised (UP-) pregnant women. Whole blood flow cytometry demonstrated an increase (p=0.027) in the baseline frequency of IFNγ-positive CD3(+)CD4(-)(CD8(+)) T cells in UP+ women. UpSV3 stimulation resulted in a significant and specific increase (p=0.001) in the frequency of IFNγ-positive CD3(+)CD4(-)(CD8(+)) T cells, regardless of vaginal colonisation status. UpSV3 stimulation also increased the frequency of IFNγ-positive CD3(+)CD4(+) T cells, particularly in the UP+ group (p=0.003). This is the first published study to examine T cell responses to Ureaplasma spp. Future appropriately-powered studies are needed to assess whether insufficient priming or a loss of tolerance to Ureaplasma spp. is occurring in UP+ women at risk of PTB. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

    PubMed Central

    Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

    2015-01-01

    ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine

  18. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  19. Immunogenicity of porcine P[6], P[7]-specific △VP8* rotavirus subunit vaccines with a tetanus toxoid universal T cell epitope.

    PubMed

    Wen, Xiaobo; Wei, Xiaoman; Ran, Xuhua; Ni, Hongbo; Cao, Si; Zhang, Yao

    2015-08-26

    Currently, commercial porcine rotavirus vaccines remain varied limitations. The objective of this study is to develop an alternative porcine rotavirus subunit vaccine candidate by parenteral administration, which enables to elicit robust immune responses against most prevalence porcine rotavirus strains. The bacterially-expressed porcine rotavirus P[6]- or P[7]-specific truncated VP8* (aa 64-223) recombinant protein with or without a universal tetanus toxoid CD4(+) T cell epitope P2 was generated. All the recombinant subunit proteins △VP8*s or P2-△VP8*s were of high solubility and high yields. The immunogenicity of each purified △VP8* and P2-△VP8* was evaluated in mice (10 μg/dose) or guinea pigs (20 μg/dose) immunized IM with 600 μg aluminum hydroxide three times at 2-week interval. The introduction of P2T cell epitope to P[7]-△VP8* elicited significantly higher IgG titer in mice than its absence. Comparatively, P2 epitope slightly enhanced the immunogenicity of P[6]-△VP8*. P2-P[7]△VP8* elicited high titer of neutralizing antibody against heterotypic P[7]-specific rotaviruses with varied G type combination. Our data indicated that two subunit vaccines could be plausible bivalent rotavirus vaccine candidate to provide antigenic coverage of porcine rotavirus strains of global or regional importance. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. [6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

    PubMed Central

    Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

    2006-01-01

    [6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

  1. RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878

    2013-11-01

    Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less

  2. Progesterone facilitates chromosome instability (aneuploidy) in p53 null normal mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Goepfert, T. M.; McCarthy, M.; Kittrell, F. S.; Stephens, C.; Ullrich, R. L.; Brinkley, B. R.; Medina, D.

    2000-01-01

    Mammary epithelial cells from p53 null mice have been shown recently to exhibit an increased risk for tumor development. Hormonal stimulation markedly increased tumor development in p53 null mammary cells. Here we demonstrate that mammary tumors arising in p53 null mammary cells are highly aneuploid, with greater than 70% of the tumor cells containing altered chromosome number and a mean chromosome number of 56. Normal mammary cells of p53 null genotype and aged less than 14 wk do not exhibit aneuploidy in primary cell culture. Significantly, the hormone progesterone, but not estrogen, increases the incidence of aneuploidy in morphologically normal p53 null mammary epithelial cells. Such cells exhibited 40% aneuploidy and a mean chromosome number of 54. The increase in aneuploidy measured in p53 null tumor cells or hormonally stimulated normal p53 null cells was not accompanied by centrosome amplification. These results suggest that normal levels of progesterone can facilitate chromosomal instability in the absence of the tumor suppressor gene, p53. The results support the emerging hypothesis based both on human epidemiological and animal model studies that progesterone markedly enhances mammary tumorigenesis.

  3. An inducible transgenic mouse breast cancer model for the analysis of tumor antigen specific CD8+ T-cell responses

    PubMed Central

    Bruns, Michael; Wanger, Jara; Utermöhlen, Olaf; Deppert, Wolfgang

    2015-01-01

    In Simian virus 40 (SV40) transgenic BALB/c WAP-T mice tumor development and progression is driven by SV40 tumor antigens encoded by inducible transgenes. WAP-T mice constitute a well characterized mouse model for breast cancer with strong similarities to the corresponding human disease. BALB/c mice mount only a weak cellular immune response against SV40 T-antigen (T-Ag). For studying tumor antigen specific CD8+ T-cell responses against transgene expressing cells, we created WAP-TNP mice, in which the transgene additionally codes for the NP118–126-epitope contained within the nucleoprotein of lymphocytic choriomeningitis virus (LCMV), the immune-dominant T-cell epitope in BALB/c mice. We then investigated in WAP-TNP mice the immune responses against SV40 tumor antigens and the NP-epitope within the chimeric T-Ag/NP protein (T-AgNP). Analysis of the immune-reactivity against T-Ag in WAP-T and of T-AgNP in WAP-TNP mice revealed that, in contrast to wild type (wt) BALB/c mice, WAP-T and WAP-TNP mice were non-reactive against T-Ag. However, like wtBALB/c mice, WAP-T as well as WAP-TNP mice were highly reactive against the immune-dominant LCMV NP-epitope, thereby allowing the analysis of NP-epitope specific cellular immune responses in WAP-TNP mice. LCMV infection of WAP-TNP mice induced a strong, LCMV NP-epitope specific CD8+ T-cell response, which was able to specifically eliminate T-AgNP expressing mammary epithelial cells both prior to tumor formation (i.e. in cells of lactating mammary glands), as well as in invasive tumors. Elimination of tumor cells, however, was only transient, even after repeated LCMV infections. Further studies showed that already non-infected WAP-TNP tumor mice contained LCMV NP-epitope specific CD8+ T-cells, albeit with strongly reduced, though measurable activity. Functional impairment of these ‘endogenous’ NP-epitope specific T-cells seems to be caused by expression of the programmed death-1 protein (PD1), as anti-PD1 treatment of

  4. Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer

    PubMed Central

    Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel

    2016-01-01

    Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766

  5. p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

    PubMed

    Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

    1998-09-01

    The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

  6. Identical Strength of the T Cell Responses against E2, nsP1 and Capsid CHIKV Proteins in Recovered and Chronic Patients after the Epidemics of 2005-2006 in La Reunion Island

    PubMed Central

    Pellé, Olivier; Samri, Assia; Jaffar-Bandjee, Marie-Christine; Gasque, Philippe; Autran, Brigitte

    2013-01-01

    To characterize the immunity developed by patients infected by chikungunya virus (CHIKV), we studied the intensity and specificity of CHIKV-specific T cells mediated responses in chronic and recovered patients at 12 to 24 months post-infection. T cells were challenged in vitro against CHIKV synthetic peptides covering the length of three viral proteins, capsid, E2 and nsP1 proteins as well as all inactivated virus particles. Cytokine production was assessed by ELISPOT and intracellular labeling. T cells producing IFN-γ were detected against CHIKV in 85% patient’s cells either by direct ELISPOT assay (69% of patients) or after expansion of memory T cells allowing the detection of both CD4 and CD8 specific-T cells in 16% additional cases. The IFN-γ response was mainly engaged in response to nsP1 or E2 (52% and 46% cases, respectively) but in only 27% cases against the capsid. The anti-E2 response represented half the magnitude of the total CHIKV IFN-γ production and was mainly directed against the C-terminal half part of the protein. Almost all patients had conserved a T cell specific response against CHIKV with a clear hierarchy of T cell responses (CD8 > CD4) engaged against E2 > nsP1 > capsid. More importantly, the intensity of responses was not significantly different between recovered and chronic patients. These findings constitute key elements to a better understanding of patient T cell immunoreactivity against CHIKV and argue against a possible defect of T cell immunoresponse in the chronicity post-CHIKV infection. PMID:24376836

  7. Antigen-specific T cell responses to BK polyomavirus antigens identify functional anti-viral immunity and may help to guide immunosuppression following renal transplantation

    PubMed Central

    Chakera, A; Bennett, S; Lawrence, S; Morteau, O; Mason, P D; O'Callaghan, C A; Cornall, R J

    2011-01-01

    Infection with the polyoma virus BK (BKV) is a major cause of morbidity following renal transplantation. Limited understanding of the anti-viral immune response has prevented the design of a strategy that balances treatment with the preservation of graft function. The proven utility of interferon-gamma enzyme-linked immunospot (ELISPOT) assays to measure T cell responses in immunocompetent hosts was the basis for trying to develop a rational approach to the management of BKV following renal transplantation. In a sample of transplant recipients and healthy controls, comparisons were made between T cell responses to the complete panel of BKV antigens, the Epstein–Barr virus (EBV) antigens, BZLF1 and EBNA1, and the mitogen phytohaemagglutinin (PHA). Correlations between responses to individual antigens and immunosuppressive regimens were also analysed. Antigen-specific T cell responses were a specific indicator of recent or ongoing recovery from BKV infection (P < 0·05), with responses to different BKV antigens being highly heterogeneous. Significant BKV immunity was undetectable in transplant patients with persistent viral replication or no history of BKV reactivation. Responses to EBV antigens and mitogen were reduced in patients with BKV reactivation, but these differences were not statistically significant. The T cell response to BKV antigens is a useful and specific guide to recovery from BKV reactivation in renal transplant recipients, provided that the full range of antigenic responses is measured. PMID:21671906

  8. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  9. Dynamic monitoring of p53 translocation to mitochondria for the analysis of specific inhibitors using luciferase-fragment complementation.

    PubMed

    Noda, Natsumi; Awais, Raheela; Sutton, Robert; Awais, Muhammad; Ozawa, Takeaki

    2017-12-01

    Intracellular protein translocation plays a pivotal role in regulating complex biological processes, including cell death. The tumor suppressor p53 is a transcription factor activated by DNA damage and oxidative stress that also translocates from the cytosol into the mitochondrial matrix to facilitate necrotic cell death. However, specific inhibitors of p53 mitochondrial translocation are largely unknown. To explore the inhibitors of p53, we developed a bioluminescent probe to monitor p53 translocation from cytosol to mitochondria using luciferase fragment complementation assays. The probe is composed of a novel pair of luciferase fragments, the N-terminus of green click beetle luciferase CBG68 (CBGN) and multiple-complement luciferase fragment (McLuc1). The combination of luciferase fragments showed significant luminescence intensity and high signal-to-background ratio. When the p53 connected with McLuc1 translocates from cytosol into mitochondrial matrix, CBGN in mitochondrial matrix enables to complement with McLuc1, resulting in the restoration of the luminescence. The luminescence intensity was significantly increased under hydrogen peroxide-induced oxidative stress following the complementation of CBGN and McLuc1. Pifithrin-μ, a selective inhibitor of p53 mitochondrial translocation, prevented the mitochondrial translocation of the p53 probe in a concentration-dependent manner. Furthermore, the high luminescence intensity made it easier to visualize the p53 translocation at a single cell level under a bioluminescence microscope. This p53 mitochondrial translocation assay is a new tool for high-throughput screening to identify novel p53 inhibitors, which could be developed as drugs to treat diseases in which necrotic cell death is a major contributor. © 2017 Wiley Periodicals, Inc.

  10. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

    PubMed

    Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

    2010-11-01

    Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    PubMed

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  12. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    PubMed

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  13. mTORC1 and p53

    PubMed Central

    Hasty, Paul; Sharp, Zelton Dave; Curiel, Tyler J.; Campisi, Judith

    2013-01-01

    A balance must be struck between cell growth and stress responses to ensure that cells proliferate without accumulating damaged DNA. This balance means that optimal cell proliferation requires the integration of pro-growth and stress-response pathways. mTOR (mechanistic target of rapamycin) is a pleiotropic kinase found in complex 1 (mTORC1). The mTORC1 pathway governs a response to mitogenic signals with high energy levels to promote protein synthesis and cell growth. In contrast, the p53 DNA damage response pathway is the arbiter of cell proliferation, restraining mTORC1 under conditions of genotoxic stress. Recent studies suggest a complicated integration of these pathways to ensure successful cell growth and proliferation without compromising genome maintenance. Deciphering this integration could be key to understanding the potential clinical usefulness of mTORC1 inhibitors like rapamycin. Here we discuss how these p53-mTORC1 interactions might play a role in the suppression of cancer and perhaps the development of cellular senescence and organismal aging. PMID:23255104

  14. On p53 revival using system oriented drug dosage design.

    PubMed

    Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar

    2017-02-21

    We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The

  15. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  16. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  17. Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

    PubMed Central

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

    2014-01-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

  18. Sequential Dysfunction and Progressive Depletion of Candida albicans-Specific CD4 T Cell Response in HIV-1 Infection

    PubMed Central

    Liu, Fengliang; Fan, Xiuzhen; Auclair, Sarah; Ferguson, Monique; Sun, Jiaren; Soong, Lynn; Hou, Wei; Redfield, Robert R.; Birx, Deborah L.; Ratto-Kim, Silvia; Robb, Merlin L.; Kim, Jerome H.; Michael, Nelson L.; Hu, Haitao

    2016-01-01

    Loss of immune control over opportunistic infections can occur at different stages of HIV-1 (HIV) disease, among which mucosal candidiasis caused by the fungal pathogen Candida albicans (C. albicans) is one of the early and common manifestations in HIV-infected human subjects. The underlying immunological basis is not well defined. We have previously shown that compared to cytomegalovirus (CMV)-specific CD4 cells, C. albicans-specific CD4 T cells are highly permissive to HIV in vitro. Here, based on an antiretroviral treatment (ART) naïve HIV infection cohort (RV21), we investigated longitudinally the impact of HIV on C. albicans- and CMV-specific CD4 T-cell immunity in vivo. We found a sequential dysfunction and preferential depletion for C. albicans-specific CD4 T cell response during progressive HIV infection. Compared to Th1 (IFN-γ, MIP-1β) functional subsets, the Th17 functional subsets (IL-17, IL-22) of C. albicans-specific CD4 T cells were more permissive to HIV in vitro and impaired earlier in HIV-infected subjects. Infection history analysis showed that C. albicans-specific CD4 T cells were more susceptible to HIV in vivo, harboring modestly but significantly higher levels of HIV DNA, than CMV-specific CD4 T cells. Longitudinal analysis of HIV-infected individuals with ongoing CD4 depletion demonstrated that C. albicans-specific CD4 T-cell response was preferentially and progressively depleted. Taken together, these data suggest a potential mechanism for earlier loss of immune control over mucosal candidiasis in HIV-infected patients and provide new insights into pathogen-specific immune failure in AIDS pathogenesis. PMID:27280548

  19. A Missing PD-L1/PD-1 Coinhibition Regulates Diabetes Induction by Preproinsulin-Specific CD8 T-Cells in an Epitope-Specific Manner

    PubMed Central

    Schuster, Cornelia; Brosi, Helen; Stifter, Katja; Boehm, Bernhard O.; Schirmbeck, Reinhold

    2013-01-01

    Coinhibitory PD-1/PD-L1 (B7-H1) interactions provide critical signals for the regulation of autoreactive T-cell responses. We established mouse models, expressing the costimulator molecule B7.1 (CD80) on pancreatic beta cells (RIP-B7.1 tg mice) or are deficient in coinhibitory PD-L1 or PD-1 molecules (PD-L1−/− and PD-1−/− mice), to study induction of preproinsulin (ppins)-specific CD8 T-cell responses and experimental autoimmune diabetes (EAD) by DNA-based immunization. RIP-B7.1 tg mice allowed us to identify two CD8 T-cell specificities: pCI/ppins DNA exclusively induced Kb/A12–21-specific CD8 T-cells and EAD, whereas pCI/ppinsΔA12–21 DNA (encoding ppins without the COOH-terminal A12–21 epitope) elicited Kb/B22–29-specific CD8 T-cells and EAD. Specific expression/processing of mutant ppinsΔA12–21 (but not ppins) in non-beta cells, targeted by intramuscular DNA-injection, thus facilitated induction of Kb/B22–29-specific CD8 T-cells. The A12–21 epitope binds Kb molecules with a very low avidity as compared with B22–29. Interestingly, immunization of coinhibition-deficient PD-L1−/− or PD-1−/− mice with pCI/ppins induced Kb/A12–21-monospecific CD8 T-cells and EAD but injections with pCI/ppinsΔA12–21 did neither recruit Kb/B22–29-specific CD8 T-cells into the pancreatic target tissue nor induce EAD. PpinsΔA12–21/(Kb/B22–29)-mediated EAD was efficiently restored in RIP-B7.1+/PD-L1−/− mice, differing from PD-L1−/− mice only in the tg B7.1 expression in beta cells. Alternatively, an ongoing beta cell destruction and tissue inflammation, initiated by ppins/(Kb/A12–21)-specific CD8 T-cells in pCI/ppins+pCI/ppinsΔA12–21 co-immunized PD-L1−/− mice, facilitated the expansion of ppinsΔA12–21/(Kb/B22–29)-specific CD8 T-cells. CD8 T-cells specific for the high-affinity Kb/B22–29- (but not the low-affinity Kb/A12–21)-epitope thus require stimulatory ´help from beta cells or inflamed islets to expand in PD-L1

  20. Oncogenic RAS Enables DNA Damage- and p53-Dependent Differentiation of Acute Myeloid Leukemia Cells in Response to Chemotherapy

    PubMed Central

    Meyer, Mona; Rübsamen, Daniela; Slany, Robert; Illmer, Thomas; Stabla, Kathleen; Roth, Petra; Stiewe, Thorsten

    2009-01-01

    Acute myeloid leukemia (AML) is a clonal disease originating from myeloid progenitor cells with a heterogeneous genetic background. High-dose cytarabine is used as the standard consolidation chemotherapy. Oncogenic RAS mutations are frequently observed in AML, and are associated with beneficial response to cytarabine. Why AML-patients with oncogenic RAS benefit most from high-dose cytarabine post-remission therapy is not well understood. Here we used bone marrow cells expressing a conditional MLL-ENL-ER oncogene to investigate the interaction of oncogenic RAS and chemotherapeutic agents. We show that oncogenic RAS synergizes with cytotoxic agents such as cytarabine in activation of DNA damage checkpoints, resulting in a p53-dependent genetic program that reduces clonogenicity and increases myeloid differentiation. Our data can explain the beneficial effects observed for AML patients with oncogenic RAS treated with higher dosages of cytarabine and suggest that induction of p53-dependent differentiation, e.g. by interfering with Mdm2-mediated degradation, may be a rational approach to increase cure rate in response to chemotherapy. The data also support the notion that the therapeutic success of cytotoxic drugs may depend on their ability to promote the differentiation of tumor-initiating cells. PMID:19890398

  1. The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.

    PubMed

    Kim, H; You, S; Foster, L K; Farris, J; Foster, D N

    2001-08-23

    The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.

  2. ESAT-6 Targeting to DEC205+ Antigen Presenting Cells Induces Specific-T Cell Responses against ESAT-6 and Reduces Pulmonary Infection with Virulent Mycobacterium tuberculosis.

    PubMed

    Silva-Sánchez, Aarón; Meza-Pérez, Selene; Flores-Langarica, Adriana; Donis-Maturano, Luis; Estrada-García, Iris; Calderón-Amador, Juana; Hernández-Pando, Rogelio; Idoyaga, Juliana; Steinman, Ralph M; Flores-Romo, Leopoldo

    2015-01-01

    Airways infection with Mycobacterium tuberculosis (Mtb) is contained mostly by T cell responses, however, Mtb has developed evasion mechanisms which affect antigen presenting cell (APC) maturation/recruitment delaying the onset of Ag-specific T cell responses. Hypothetically, bypassing the natural infection routes by delivering antigens directly to APCs may overcome the pathogen's naturally evolved evasion mechanisms, thus facilitating the induction of protective immune responses. We generated a murine monoclonal fusion antibody (α-DEC-ESAT) to deliver Early Secretory Antigen Target (ESAT)-6 directly to DEC205+ APCs and to assess its in vivo effects on protection associated responses (IFN-γ production, in vivo CTL killing, and pulmonary mycobacterial load). Treatment with α-DEC-ESAT alone induced ESAT-6-specific IFN-γ producing CD4+ T cells and prime-boost immunization prior to Mtb infection resulted in early influx (d14 post-infection) and increased IFN-γ+ production by specific T cells in the lungs, compared to scarce IFN-γ production in control mice. In vivo CTL killing was quantified in relevant tissues upon transferring target cells loaded with mycobacterial antigens. During infection, α-DEC-ESAT-treated mice showed increased target cell killing in the lungs, where histology revealed cellular infiltrate and considerably reduced bacterial burden. Targeting the mycobacterial antigen ESAT-6 to DEC205+ APCs before infection expands specific T cell clones responsible for early T cell responses (IFN-γ production and CTL activity) and substantially reduces lung bacterial burden. Delivering mycobacterial antigens directly to APCs provides a unique approach to study in vivo the role of APCs and specific T cell responses to assess their potential anti-mycobacterial functions.

  3. ESAT-6 Targeting to DEC205+ Antigen Presenting Cells Induces Specific-T Cell Responses against ESAT-6 and Reduces Pulmonary Infection with Virulent Mycobacterium tuberculosis

    PubMed Central

    Silva-Sánchez, Aarón; Meza-Pérez, Selene; Flores-Langarica, Adriana; Donis-Maturano, Luis; Estrada-García, Iris; Calderón-Amador, Juana; Hernández-Pando, Rogelio; Idoyaga, Juliana; Flores-Romo, Leopoldo

    2015-01-01

    Airways infection with Mycobacterium tuberculosis (Mtb) is contained mostly by T cell responses, however, Mtb has developed evasion mechanisms which affect antigen presenting cell (APC) maturation/recruitment delaying the onset of Ag-specific T cell responses. Hypothetically, bypassing the natural infection routes by delivering antigens directly to APCs may overcome the pathogen’s naturally evolved evasion mechanisms, thus facilitating the induction of protective immune responses. We generated a murine monoclonal fusion antibody (α-DEC-ESAT) to deliver Early Secretory Antigen Target (ESAT)-6 directly to DEC205+ APCs and to assess its in vivo effects on protection associated responses (IFN-γ production, in vivo CTL killing, and pulmonary mycobacterial load). Treatment with α-DEC-ESAT alone induced ESAT-6-specific IFN-γ producing CD4+ T cells and prime-boost immunization prior to Mtb infection resulted in early influx (d14 post-infection) and increased IFN-γ+ production by specific T cells in the lungs, compared to scarce IFN-γ production in control mice. In vivo CTL killing was quantified in relevant tissues upon transferring target cells loaded with mycobacterial antigens. During infection, α-DEC-ESAT-treated mice showed increased target cell killing in the lungs, where histology revealed cellular infiltrate and considerably reduced bacterial burden. Targeting the mycobacterial antigen ESAT-6 to DEC205+ APCs before infection expands specific T cell clones responsible for early T cell responses (IFN-γ production and CTL activity) and substantially reduces lung bacterial burden. Delivering mycobacterial antigens directly to APCs provides a unique approach to study in vivo the role of APCs and specific T cell responses to assess their potential anti-mycobacterial functions. PMID:25915045

  4. Methionine sulfoxide reductase A regulates cell growth through the p53-p21 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Seung Hee; Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr

    2011-12-09

    Highlights: Black-Right-Pointing-Pointer Down-regulation of MsrA inhibits normal cell proliferation. Black-Right-Pointing-Pointer MsrA deficiency leads to an increase in p21 by enhanced p53 acetylation. Black-Right-Pointing-Pointer Down-regulation of MsrA causes cell cycle arrest at the G{sub 2}/M stage. Black-Right-Pointing-Pointer MsrA is a regulator of cell growth that mediates the p53-p21 pathway. -- Abstract: MsrA is an oxidoreductase that catalyzes the stereospecific reduction of methionine-S-sulfoxide to methionine. Although MsrA is well-characterized as an antioxidant and has been implicated in the aging process and cellular senescence, its roles in cell proliferation are poorly understood. Here, we report a critical role of MsrA in normal cellmore » proliferation and describe the regulation mechanism of cell growth by this protein. Down-regulation of MsrA inhibited cell proliferation, but MsrA overexpression did not promote it. MsrA deficiency led to an increase in p21, a major cyclin-dependent kinase inhibitor, thereby causing cell cycle arrest at the G{sub 2}/M stage. While protein levels of p53 were not altered upon MsrA deficiency, its acetylation level was significantly elevated, which subsequently activated p21 transcription. The data suggest that MsrA is a regulator of cell growth that mediates the p53-p21 pathway.« less

  5. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

    Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

  6. C2-streptavidin mediates the delivery of biotin-conjugated tumor suppressor protein p53 into tumor cells.

    PubMed

    Fahrer, Jörg; Schweitzer, Brigitte; Fiedler, Katja; Langer, Torben; Gierschik, Peter; Barth, Holger

    2013-04-17

    We have previously generated a recombinant C2-streptavidin fusion protein for the delivery of biotin-labeled molecules of low molecular weight into the cytosol of mammalian cells. A nontoxic moiety of Clostridium botulinum C2 toxin mediates the cellular uptake, whereas the streptavidin unit serves as a binding platform for biotin-labeled cargo molecules. In the present study, we used the C2-streptavidin transporter to introduce biotin-conjugated p53 protein into various mammalian cell lines. The p53 tumor suppressor protein is inactivated in many human cancers by multiple mechanisms and therefore the restoration of its activity in tumor cells is of great therapeutic interest. Recombinant p53 was expressed in insect cells and biotin-labeled. Biotin-p53 retained its specific high-affinity DNA-binding as revealed by gel-shift analysis. Successful conjugation of biotin-p53 to the C2-streptavidin transporter was monitored by an overlay blot technique and confirmed by real-time surface plasmon resonance, providing a KD-value in the low nM range. C2-streptavidin significantly enhanced the uptake of biotin-p53 into African Green Monkey (Vero) epithelial cells as shown by flow cytometry. Using cell fractionation, the cytosolic translocation of biotin-p53 was detected in Vero cells as well as in HeLa cervix carcinoma cells. In line with this finding, confocal microscopy displayed cytoplasmic staining of biotin-p53 in HeLa and HL60 leukemia cells. Internalized biotin-p53 partially colocalized with early endosomes, as confirmed by confocal microscopy. In conclusion, our results demonstrate the successful conjugation of biotin-p53 to C2-streptavidin and its subsequent receptor-mediated endocytosis into different human tumor cell lines.

  7. Relative biological effectiveness of light ions in human tumoural cell lines: role of protein p53

    NASA Technical Reports Server (NTRS)

    Baggio, L.; Cavinato, M.; Cherubini, R.; Conzato, M.; Cucinotta, F.; Favaretto, S.; Gerardi, S.; Lora, S.; Stoppa, P.; Williams, J. R.

    2002-01-01

    Protons and alpha particles of high linear energy transfer (LET) have shown an increased relative biological effectiveness (RBE) with respect to X/gamma rays for several cellular and molecular endpoints in different in vitro cell systems. To contribute to understanding the biochemical mechanisms involved in the increased effectiveness of high LET radiation, an extensive study has been designed. The present work reports the preliminary result of this study on two human tumoural cell lines, DLD1 and HCT116, (with different p53 status), which indicate that for these cell lines, p53 does not appear to take a part in the response to radiation induced DNA damage, suggesting an alternative p53-independent pathway and a cell biochemical mechanism dependent on the cell type.

  8. Redirecting T-cell specificity by introducing a tumor-specific chimeric antigen receptor

    PubMed Central

    Jena, Bipulendu; Dotti, Gianpietro

    2010-01-01

    Infusions of antigen-specific T cells have yielded therapeutic responses in patients with pathogens and tumors. To broaden the clinical application of adoptive immunotherapy against malignancies, investigators have developed robust systems for the genetic modification and characterization of T cells expressing introduced chimeric antigen receptors (CARs) to redirect specificity. Human trials are under way in patients with aggressive malignancies to test the hypothesis that manipulating the recipient and reprogramming T cells before adoptive transfer may improve their therapeutic effect. These examples of personalized medicine infuse T cells designed to meet patients' needs by redirecting their specificity to target molecular determinants on the underlying malignancy. The generation of clinical grade CAR+ T cells is an example of bench-to-bedside translational science that has been accomplished using investigator-initiated trials operating largely without industry support. The next-generation trials will deliver designer T cells with improved homing, CAR-mediated signaling, and replicative potential, as investigators move from the bedside to the bench and back again. PMID:20439624

  9. Direct regulation of RNA polymerase III transcription by RB, p53 and c-Myc.

    PubMed

    Felton-Edkins, Zoë A; Kenneth, Niall S; Brown, Timothy R P; Daly, Nicole L; Gomez-Roman, Natividad; Grandori, Carla; Eisenman, Robert N; White, Robert J

    2003-01-01

    The synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is cell cycle regulated in higher organisms. Overexpression of pol III products is a general feature of transformed cells. These observations may be explained by the fact that a pol III-specific transcription factor, TFIIIB, is strongly regulated by the tumor suppressors RB and p53, as well as the proto-oncogene product c-Myc. RB and p53 repress TFIIIB, but this restraint can be lost in tumors through a variety of mechanisms. In contrast, c-Myc binds and activates TFIIIB, causing potent induction of pol III transcription. Using chromatin immunoprecipitation and RNA interference, we show that c-Myc interacts with tRNA and 5S rRNA genes in transformed cervical cells, stimulating their expression. Availability of pol III products may be an important determinant of a cell's capacity to grow. The ability to regulate pol III output may therefore be integral to the growth control functions of RB, p53 and c-Myc.

  10. Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53

    PubMed Central

    Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin

    2010-01-01

    Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991

  11. Cytomegalovirus-Specific CD4+ T-cell Responses and CMV-IgG Levels are associated with Neurocognitive Impairment in People Living with HIV.

    PubMed

    Ballegaard, Vibe; Pedersen, Karin Kaereby; Pedersen, Maria; Brændstrup, Peter; Kirkby, Nikolai; Buus, Anette Stryhn; Ryder, Lars P; Gerstoft, Jan; Nielsen, Susanne Dam

    2018-05-30

    Mechanisms leading to neurocognitive impairment (NCI) in people living with HIV (PLWHIV) on stable antiretroviral therapy (cART) remain unknown. We investigated the association between CMV immunity, HIV-specific variables and NCI in PLWHIV on stable cART and with low comorbidity. 52 PLWHIV on stable cART and 31 HIV-uninfected controls matched on age, gender, education and comorbidity were tested with a neurocognitive test-battery and CMV-immunoglobulin G (CMV-IgG) levels were measured. In PLWHIV, CMV-specific (CMV-pp65 and CMV-gB) CD4+ and CD8+ T-cell responses were measured using intracellular-cytokine-staining and flowcytometry. NCI was defined as a global-deficit-scale score (GDS-score) ≥ 0.5. GDS-scores and domain-specific-scores defined severity of NCI. Logistic and linear multivariate regression analyses were used. NCI was detected in 30.8% of PLWHIV, and HIV was associated with an adjusted odds ratio (aOR) of 5.18 (95%CI: 1.15; 23.41, p=0.033) for NCI. In PLWHIV, higher CMV-specific CD4+ T-cell responses increased the probability of NCI with an aOR of 1.68 (95%CI: 1.10; 2.57) for CMV-pp65 or an aOR of 3.73 (95%CI: 1.61; 16.98) for CMV-gB, respectively. Similar associations were not found with CMV-IgG or CMV-specific CD8+ T-cells, but when assessing severity of NCI, higher CMV-IgG (per 100 U/ml) was associated with worse GDS-scores (β=0.08 (0.01-0.16), p=0.044), specifically in the domain of speed of information processing (β=0.20 (0.04-0.36, p=0.019). PLWHIV had increased risk of NCI. Excess risk may be associated with CMV-specific CD4+ T-cell responses and CMV-IgG. Larger longitudinal studies investigating the impact of CMV immunity on risk of NCI are warranted.

  12. Inhibition of phosphoantigen-mediated gammadelta T-cell proliferation by CD4+ CD25+ FoxP3+ regulatory T cells.

    PubMed

    Kunzmann, Volker; Kimmel, Brigitte; Herrmann, Thomas; Einsele, Hermann; Wilhelm, Martin

    2009-02-01

    Tumour growth promotes the expansion of CD4(+) CD25(+) FoxP3(+) regulatory T cells (Tregs) which suppress various arms of immune responses and might therefore contribute to tumour immunosurveillance. In this study, we found an inverse correlation between circulating Treg frequencies and phosphoantigen-induced gammadelta T-cell proliferation in cancer patients, which prompted us to address the role of Tregs in controlling the gammadelta T-cell arm of innate immune responses. In vitro, human Treg-peripheral blood mononuclear cell (PBMC) co-cultures strongly inhibited phosphoantigen-induced proliferation of gammadelta T cells and depletion of Tregs restored the impaired phosphoantigen-induced gammadelta T-cell proliferation of cancer patients. Tregs did not suppress other effector functions of gammadelta T cells such as cytokine production or cytotoxicity. Our experiments indicate that Tregs do not mediate their suppressive activity via a cell-cell contact-dependent mechanism, but rather secrete a soluble non-proteinaceous factor, which is independent of known soluble factors interacting with amino acid depletion (e.g. arginase-diminished arginine and indolamine 2,3-dioxygenase-diminished tryptophan) or nitric oxide (NO) production. However, the proliferative activity of alphabeta T cells was not affected by this cell-cell contact-independent suppressive activity induced by Tregs. In conclusion, these findings indicate a potential new mechanism by which Tregs can specifically suppress gammadelta T cells and highlight the strategy of combining Treg inhibition with subsequent gammadelta T-cell activation to enhance gammadelta T cell-mediated immunotherapy.

  13. Lentiviral Protein Transfer Vectors Are an Efficient Vaccine Platform and Induce a Strong Antigen-Specific Cytotoxic T Cell Response

    PubMed Central

    Uhlig, Katharina M.; Schülke, Stefan; Scheuplein, Vivian A. M.; Malczyk, Anna H.; Reusch, Johannes; Kugelmann, Stefanie; Muth, Anke; Koch, Vivian; Hutzler, Stefan; Bodmer, Bianca S.; Schambach, Axel; Buchholz, Christian J.; Waibler, Zoe; Scheurer, Stephan

    2015-01-01

    ABSTRACT To induce and trigger innate and adaptive immune responses, antigen-presenting cells (APCs) take up and process antigens. Retroviral particles are capable of transferring not only genetic information but also foreign cargo proteins when they are genetically fused to viral structural proteins. Here, we demonstrate the capacity of lentiviral protein transfer vectors (PTVs) for targeted antigen transfer directly into APCs and thereby induction of cytotoxic T cell responses. Targeting of lentiviral PTVs to APCs can be achieved analogously to gene transfer vectors by pseudotyping the particles with truncated wild-type measles virus (MV) glycoproteins (GPs), which use human SLAM (signaling lymphocyte activation molecule) as a main entry receptor. SLAM is expressed on stimulated lymphocytes and APCs, including dendritic cells. SLAM-targeted PTVs transferred the reporter protein green fluorescent protein (GFP) or Cre recombinase with strict receptor specificity into SLAM-expressing CHO and B cell lines, in contrast to broadly transducing vesicular stomatitis virus G protein (VSV-G) pseudotyped PTVs. Primary myeloid dendritic cells (mDCs) incubated with targeted or nontargeted ovalbumin (Ova)-transferring PTVs stimulated Ova-specific T lymphocytes, especially CD8+ T cells. Administration of Ova-PTVs into SLAM-transgenic and control mice confirmed the observed predominant induction of antigen-specific CD8+ T cells and demonstrated the capacity of protein transfer vectors as suitable vaccines for the induction of antigen-specific immune responses. IMPORTANCE This study demonstrates the specificity and efficacy of antigen transfer by SLAM-targeted and nontargeted lentiviral protein transfer vectors into antigen-presenting cells to trigger antigen-specific immune responses in vitro and in vivo. The observed predominant activation of antigen-specific CD8+ T cells indicates the suitability of SLAM-targeted and also nontargeted PTVs as a vaccine for the induction of

  14. Involvement of 53BP1, a p53 Binding Protein, in Chk2 Phosphyorylation of p53 and DNA Damage Cell Cycle Checkpoints

    DTIC Science & Technology

    2006-05-01

    between 53BP1 and the platelet derived growth factor (PDGF) was recently identified in a patient with a myeloproliferative disorder.32 The 53BP1-PDGF...receptor beta in a patient with a t(5;15)(q33;q22) and an imatinib-responsive eosinophilic myeloproliferative disorder. Cancer Res 2004; 64:7216-9

  15. The pyrimidin analogue cyclopentenyl cytosine induces alloantigen-specific non-responsiveness of human T lymphocytes

    PubMed Central

    Nikolaeva, N; Bemelman, F J; Yong, S-L; Verschuur, A; van Lier, R A W; ten Berge, I J M

    2008-01-01

    Cyclopentenyl cytosine (CPEC) has been shown to induce apoptosis in human T lymphoblastic cell lines and T cells from leukaemia patients. In this study we have addressed the question of whether CPEC is able to decrease proliferation and effector functions of human alloresponsive T lymphocytes and induce T cell anergy. The proliferative capacity of human peripheral blood mononuclear cells in response to allogeneic stimulation was measured by 5,6-carboxy-succinimidyl-diacetate-fluorescein-ester staining. Flow cytometric analysis was performed using surface CD4, CD8, CD25, CD103 and intracellular perforin, granzyme A, granzyme B, caspase-3 and forkhead box P3 (FoxP3) markers. The in vivo immunosuppressive capacity was tested in a murine skin graft model. Addition of CPEC at a concentration of 20 nM strongly decreased the expansion and cytotoxicity of alloreactive T cells. Specific restimulation in the absence of CPEC showed that the cells became anergic. The drug induced caspase-dependent apoptosis of alloreactive T lymphocytes. Finally, CPEC increased the percentage of CD25high FoxP3+ CD4+ and CD103+ CD8+ T cells, and potentiated the effect of rapamycin in increasing the numbers of alloreactive regulatory T cells. Treatment with CPEC of CBA/CA mice transplanted with B10/Br skin grafts significantly prolonged graft survival. We conclude that CPEC inhibits proliferation and cytotoxicity of human alloreactive T cells and induces alloantigen non-responsiveness in vitro. PMID:18062797

  16. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    PubMed

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  17. Loss of Atrx Sensitizes Cells to DNA Damaging Agents through p53-Mediated Death Pathways

    PubMed Central

    Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J.; Picketts, David J.

    2012-01-01

    Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx f/f mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors. PMID:23284920

  18. Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.

    PubMed

    Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J; Picketts, David J

    2012-01-01

    Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f) mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors.

  19. Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation but Does Not Alter Cell Survival following DNA Damage

    PubMed Central

    Solomon, Jonathan M.; Pasupuleti, Rao; Xu, Lei; McDonagh, Thomas; Curtis, Rory; DiStefano, Peter S.; Huber, L. Julie

    2006-01-01

    Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells. PMID:16354677

  20. 2-Phenylacetylenesulfonamide (PAS) induces p53-independent apoptotic killing of B-chronic lymphocytic leukemia (CLL) cells.

    PubMed

    Steele, Andrew J; Prentice, Archibald G; Hoffbrand, A Victor; Yogashangary, Birunthini C; Hart, Stephen M; Lowdell, Mark W; Samuel, Edward R; North, Janet M; Nacheva, Elisabeth P; Chanalaris, Anastasios; Kottaridis, Panagiotis; Cwynarski, Kate; Wickremasinghe, R Gitendra

    2009-08-06

    We studied the actions of 2-phenylacetylenesulfonamide (PAS) on B-chronic lymphocytic leukemia (CLL) cells. PAS (5-20 microM) initiated apoptosis within 24 hours, with maximal death at 48 hours asassessed by morphology, cleavage of poly(ADP-ribose) polymerase (PARP), caspase 3 activation, and annexin V staining. PAS treatment induced Bax proapoptotic conformational change, Bax movement from the cytosol to the mitochondria, and cytochrome c release, indicating that PAS induced apoptosis via the mitochondrial pathway. PAS induced approximately 3-fold up-regulation of proapoptotic Noxa protein and mRNA levels. In addition, Noxa was found unexpectedly to be bound to Bcl-2 in PAS-treated cells. PAS treatment of CLL cells failed to up-regulate p53, suggesting that PAS induced apoptosis independently of p53. Furthermore, PAS induced apoptosis in CLL isolates with p53 gene deletion in more than 97% of cells. Normal B lymphocytes were as sensitive to PAS-induced Noxa up-regulation and apoptosis as were CLL cells. However, both T lymphocytes and bone marrow hematopoietic progenitor cells were relatively resistant to PAS. Our data suggest that PAS may represent a novel class of drug that induces apoptosis in CLL cells independently of p53 status by a mechanism involving Noxa up-regulation.

  1. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    PubMed Central

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  2. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    PubMed

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR

    PubMed Central

    Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

    2010-01-01

    Summary The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca2+-independent-phospholipase A2 (iPLA2). We previously reported that inhibition of iPLA2 arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA2 induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA2. The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA2-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway. PMID:18032786

  4. The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR.

    PubMed

    Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

    2007-12-01

    The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca(2+)-independent-phospholipase A(2) (iPLA(2)). We previously reported that inhibition of iPLA(2) arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA(2) induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA(2). The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA(2)-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway.

  5. Polyfunctional analysis of Gag and Nef specific CD8+ T-cell responses in HIV-1 infected Indian individuals.

    PubMed

    Mendiratta, Sanjay; Vajpayee, Madhu; Mojumdar, Kamalika; Chauhan, Neeraj K; Sreenivas, Vishnubhatla

    2011-02-01

    Polyfunctional CD8+ T-cells have been described as most competent in controlling viral replication. We studied the impact of antigen persistence on the polyfunctional immune responses of CD8+ T-lymphocytes to HIV Gag and Nef peptides and polyclonal stimuli in 40 ART naïve HIV infected individuals and analyzed the alterations in T-cell functionality in early and late stages of infection. Significantly elevated level of global response and polyfunctional profile of CD8+ T-cells were observed to polyclonal stimulation, than HIV specific antigens in chronically infected individuals. However no key differences were observed in CD8+ T-cell functional profile in any of the 15 unique subsets for Gag and Nef specific antigens. The subjects in early stage of infection (defined as a gap of 6 months or less between seroconversion and enrolment and with no apparent clinical symptoms) had a higher degree of response functionality (4+ or 3+ different functions simultaneously) than in the late stage infection (defined as time duration since seroconversion greater than 6 months). The data suggest that persistence of antigen during chronic infection leads to functional impairment of HIV specific responses. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Antigen-Specific CD8 Lytic Phenotype Induced by Sipuleucel-T in Hormone-Sensitive or Castration-Resistant Prostate Cancer and Association With Overall Survival.

    PubMed

    Antonarakis, Emmanuel S; Small, Eric J; Petrylak, Daniel; Quinn, David I; Kibel, Adam S; Chang, Nancy; Dearstyne, Erica; Harmon, Matthew; Campogan, Dwayne; Haynes, Heather; Vu, Tuyen; Sheikh, Nadeem A; Drake, Charles G

    2018-06-01

    Sipuleucel-T is FDA-approved for the treatment of metastatic castration-resistant prostate cancer (mCRPC) based on the IMPACT trial showing a 4.1-month benefit in median overall survival (OS) for patients receiving sipuleucel-T vs control. Although efficacy of sipuleucel-T is well-established, its mechanism remains incompletely understood. Patient samples from three sipuleucel-T trials were assessed for peripheral cellular immune responses to the immunogen PA2024 and the target antigen prostatic acid phosphatase (PAP). PAP- and PA2024-specific proliferative and cytolytic responses were characterized to delineate sipuleucel-T-induced immune responses. To quantify potential cytotoxic T lymphocyte (CTL) activity, cell-surface CD107a expression on PAP- or PA2024-specific CD8+ T cells was measured in sipuleucel-T-treated patient and healthy volunteer samples. Increased PA2024-specific CD4+ (p=0.030) and CD8+ (p=0.052) T-cell proliferation from baseline to week 6 was observed (N=14) post-sipuleucel-T, with greater magnitude of PA2024-specific responses compared to PAP. PAP- and PA2024-CTL activity (CD107a positivity) significantly increased at weeks 6 and 26 after sipuleucel-T treatment (p<0.0001; N=22). At 26 weeks post-sipuleucel-T, OS correlated with the magnitude of PAP (Pearson's R, 0.52; p=0.013) or PA2024 (Pearson's R, 0.67; p=0.0006) CTL activity. Higher PA2024-CTL activity at week 26 was significantly associated with longer OS using tertile analysis (p=0.0005; N=22), with PA2024 responses correlating with PAP responses at week 26 (R=0.90; p=1.53E -08 ). This study is the first to report PAP-specific CD8+ T-cell responses elicited by sipuleucel-T treatment. Increased and persistent potential PA2024-specific CTL activity correlated with PAP-specific CTL activity and associated with improved OS following sipuleucel-T treatment. Copyright ©2018, American Association for Cancer Research.

  7. Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

    PubMed Central

    Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

    2016-01-01

    Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

  8. LRRK2 interacts with ATM and regulates Mdm2-p53 cell proliferation axis in response to genotoxic stress.

    PubMed

    Chen, Zhongcan; Cao, Zhen; Zhang, Wei; Gu, Minxia; Zhou, Zhi Dong; Li, Baojie; Li, Jing; Tan, Eng King; Zeng, Li

    2017-11-15

    Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself contributes to cancer risk remains unknown. DNA damage causes cancer, and DNA damage responses are among the most important pathways in cancer biology. To understand the role of LRRK2 in DNA damage response pathway, we induced DNA damage by applying genotoxic stress to the cells with Adriamycin. We found that DNA damage enhances LRRK2 phosphorylation at Serine 910, Serine 935 and Serine 1292. We further showed that LRRK2 phosphorylation is abolished in the absence of ATM, suggesting that LRRK2 phosphorylation requires ATM. It should also be noted that LRRK2 interacts with ATM. In contrast, overexpression or knockdown of LRRK2 does not affect ATM phosphorylation, indicating that LRRK2 is the downstream target of ATM in response to DNA damage. Moreover, we demonstrated that LRRK2 increases the expression of p53 and p21 by increasing the Mdm2 phosphorylation in response to DNA damage. Loss-of-function in LRRK2 has the opposite effect to that of LRRK2. In addition, FACS analysis revealed that LRRK2 enhances cell cycle progression into S phase in response to DNA damage, a finding that was confirmed by 5-bromo-2'-deoxyuridine immunostaining. Taken together, our findings demonstrate that LRRK2 plays an important role in the ATM-Mdm2-p53 pathway that regulates cell proliferation in response to DNA damage. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Enhancement of P53-Mutant Human Colorectal Cancer Cells Radiosensitivity by Flavonoid Fisetin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen Wenshu; Lee Yijang; Yu Yichu

    Purpose: The aim of this study was to investigate whether fisetin is a potential radiosensitizer for human colorectal cancer cells, which are relatively resistant to radiotherapy. Methods and Materials: Cell survival was examined by clonogenic survival assay, and DNA fragmentation was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling assay. The effects of treatments on cell cycle distribution and apoptosis were examined by flow cytometry. Western blot analysis was performed to ascertain the protein levels of {gamma}-H2AX, phospho-Chk2, active caspase-3, PARP cleavage, phospho-p38, phospho-AKT, and phospho-ERK1/2. Results: Fisetin pretreatment enhanced the radiosensitivity of p53-mutant HT-29 human colorectal cancer cellsmore » but not human keratocyte HaCaT cells; it also prolonged radiation-induced G{sub 2}/M arrest, enhanced radiation-induced cell growth arrest in HT-29 cells, and suppressed radiation-induced phospho-H2AX (Ser-139) and phospho-Chk2 (Thr-68) in p53-mutant HT-29 cells. Pretreatment with fisetin enhanced radiation-induced caspase-dependent apoptosis in HT-29 cells. Fisetin pretreatment augmented radiation-induced phosphorylation of p38 mitogen-activated protein kinase, which is involved in caspase-mediated apoptosis, and SB202190 significantly reduced apoptosis and radiosensitivity in fisetin-pretreated HT-29 cells. By contrast, both phospho-AKT and phospho-ERK1/2, which are involved in cell proliferation and antiapoptotic pathways, were suppressed after irradiation combined with fisetin pretreatment. Conclusions: To our knowledge, this study is the first to provide evidence that fisetin exerts a radiosensitizing effect in p53-mutant HT-29 cells. Fisetin could potentially be developed as a novel radiosensitizer against radioresistant human cancer cells.« less

  10. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

    PubMed

    Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

    2005-12-08

    TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

  11. Single-cell multiplexed cytokine profiling of CD19 CAR-T cells reveals a diverse landscape of polyfunctional antigen-specific response.

    PubMed

    Xue, Qiong; Bettini, Emily; Paczkowski, Patrick; Ng, Colin; Kaiser, Alaina; McConnell, Timothy; Kodrasi, Olja; Quigley, Máire F; Heath, James; Fan, Rong; Mackay, Sean; Dudley, Mark E; Kassim, Sadik H; Zhou, Jing

    2017-11-21

    It remains challenging to characterize the functional attributes of chimeric antigen receptor (CAR)-engineered T cell product targeting CD19 related to potency and immunotoxicity ex vivo, despite promising in vivo efficacy in patients with B cell malignancies. We employed a single-cell, 16-plex cytokine microfluidics device and new analysis techniques to evaluate the functional profile of CD19 CAR-T cells upon antigen-specific stimulation. CAR-T cells were manufactured from human PBMCs transfected with the lentivirus encoding the CD19-BB-z transgene and expanded with anti-CD3/anti-CD28 coated beads. The enriched CAR-T cells were stimulated with anti-CAR or control IgG beads, stained with anti-CD4 RPE and anti-CD8 Alexa Fluor 647 antibodies, and incubated for 16 h in a single-cell barcode chip (SCBC). Each SCBC contains ~12,000 microchambers, covered with a glass slide that was pre-patterned with a complete copy of a 16-plex antibody array. Protein secretions from single CAR-T cells were captured and subsequently analyzed using proprietary software and new visualization methods. We demonstrate a new method for single-cell profiling of CD19 CAR-T pre-infusion products prepared from 4 healthy donors. CAR-T single cells exhibited a marked heterogeneity of cytokine secretions and polyfunctional (2+ cytokine) subsets specific to anti-CAR bead stimulation. The breadth of responses includes anti-tumor effector (Granzyme B, IFN-γ, MIP-1α, TNF-α), stimulatory (GM-CSF, IL-2, IL-8), regulatory (IL-4, IL-13, IL-22), and inflammatory (IL-6, IL-17A) functions. Furthermore, we developed two new bioinformatics tools for more effective polyfunctional subset visualization and comparison between donors. Single-cell, multiplexed, proteomic profiling of CD19 CAR-T product reveals a diverse landscape of immune effector response of CD19 CAR-T cells to antigen-specific challenge, providing a new platform for capturing CAR-T product data for correlative analysis. Additionally, such high

  12. ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

    PubMed Central

    Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

  13. Tumor-specific CD4+ T cells develop cytotoxic activity and eliminate virus-induced tumor cells in the absence of regulatory T cells.

    PubMed

    Akhmetzyanova, Ilseyar; Zelinskyy, Gennadiy; Schimmer, Simone; Brandau, Sven; Altenhoff, Petra; Sparwasser, Tim; Dittmer, Ulf

    2013-02-01

    The important role of tumor-specific cytotoxic CD8(+) T cells is well defined in the immune control of the tumors, but the role of effector CD4(+) T cells is poorly understood. In the current research, we have used a murine retrovirus-induced tumor cell line of C57BL/6 mouse origin, namely FBL-3 cells, as a model to study basic mechanisms of immunological control and escape during tumor formation. This study shows that tumor-specific CD4(+) T cells are able to protect against virus-induced tumor cells. We show here that there is an expansion of tumor-specific CD4(+) T cells producing cytokines and cytotoxic molecule granzyme B (GzmB) in the early phase of tumor growth. Importantly, we demonstrate that in vivo depletion of regulatory T cells (Tregs) and CD8(+) T cells in FBL-3-bearing DEREG transgenic mice augments IL-2 and GzmB production by CD4(+) T cells and increases FV-specific CD4(+) T-cell effector and cytotoxic responses leading to the complete tumor regression. Therefore, the capacity to reject tumor acquired by tumor-reactive CD4(+) T cells largely depends on the direct suppressive activity of Tregs. We suggest that a cytotoxic CD4(+) T-cell immune response may be induced to enhance resistance against oncovirus-associated tumors.

  14. Detection of novel cancer-testis antigen-specific T-cell responses in TIL, regional lymph nodes, and PBL in patients with esophageal squamous cell carcinoma.

    PubMed

    Mizukami, Yoshiki; Kono, Koji; Daigo, Yataro; Takano, Atsushi; Tsunoda, Takuya; Kawaguchi, Yoshihiko; Nakamura, Yusuke; Fujii, Hideki

    2008-07-01

    We recently identified three HLA-A2402-restricted epitope peptides derived from cancer-testis antigens (CTA), TTK protein kinase (TTK), lymphocyte antigen 6 complex locus K (LY6K), and insulin-like growth factor (IGF)-II mRNA binding protein 3 (IMP-3) for the development of immunotherapies against esophageal squamous cell carcinoma (ESCC). In order to evaluate their immunotherapeutic potential in ESCC patients, we estimated by ELISPOT assay the TTK-, LY6K-, or IMP-3-specific T-cell immune responses in tumor-infiltrating lymphocytes (TIL), regional lymph node lymphocytes (RLNL), and peripheral blood lymphocytes (PBL) expanded from 20HLA-A2402 (+) ESCC patients, and correlated their immune activity with the expression levels of TTK, LY6K, and IMP-3, and MHC class I in the tumors. Induction of TTK-antigen specific T-cell response in TIL to the peptide-pulsed target cells was detected in 14 out of 20 (70%) cases, while LY6K or IMP-3 specific T-cell activity was observed in 11 of 20 (55%) or in eight of 20 (40%) cases, respectively. Furthermore, T-cell activity in RLNL and PBL was detectable in the similar proportion of the 20 ESCC patients. Interestingly, CTA-specific T-cell immune response was found in 13 of 14 (93%) TIL obtained from ESCC tumors with strong MHC class I expression, while it could be observed only in two of six (33%) TIL from ESCC tumors with weak MHC class I expression. These results strongly suggest the pre-existence of specific T-cell responses to HLA-A24-restricted epitope peptides from TTK, LY6K, and IMP-3 in ESCC patients. Monitoring antigen-specific T-cell responses, as well as the expression levels of MHC class I and epitope CTA in tumors, should be a selection index for application of cancer vaccine therapies to the patients who are likely to show good immune response.

  15. Cytokine Production but Lack of Proliferation in Peripheral Blood Mononuclear Cells from Chronic Chagas' Disease Cardiomyopathy Patients in Response to T. cruzi Ribosomal P Proteins

    PubMed Central

    Longhi, Silvia A.; Atienza, Augusto; Perez Prados, Graciela; Buying, Alcinette; Balouz, Virginia; Buscaglia, Carlos A.; Santos, Radleigh; Tasso, Laura M.; Bonato, Ricardo; Chiale, Pablo; Gómez, Karina A.

    2014-01-01

    Background Trypanosoma cruzi ribosomal P proteins, P2β and P0, induce high levels of antibodies in patients with chronic Chagas' disease Cardiomyopathy (CCC). It is well known that these antibodies alter the beating rate of cardiomyocytes and provoke apoptosis by their interaction with β1-adrenergic and M2-muscarinic cardiac receptors. Based on these findings, we decided to study the cellular immune response to these proteins in CCC patients compared to non-infected individuals. Methodology/Principal findings We evaluated proliferation, presence of surface activation markers and cytokine production in peripheral blood mononuclear cells (PBMC) stimulated with P2β, the C-terminal portion of P0 (CP0) proteins and T. cruzi lysate from CCC patients predominantly infected with TcVI lineage. PBMC from CCC patients cultured with P2β or CP0 proteins, failed to proliferate and express CD25 and HLA-DR on T cell populations. However, multiplex cytokine assays showed that these antigens triggered higher secretion of IL-10, TNF-α and GM-CSF by PBMC as well as both CD4+ and CD8+ T cells subsets of CCC subjects. Upon T. cruzi lysate stimulation, PBMC from CCC patients not only proliferated but also became activated within the context of Th1 response. Interestingly, T. cruzi lysate was also able to induce the secretion of GM-CSF by CD4+ or CD8+ T cells. Conclusions/Significance Our results showed that although the lack of PBMC proliferation in CCC patients in response to ribosomal P proteins, the detection of IL-10, TNF-α and GM-CSF suggests that specific T cells could have both immunoregulatory and pro-inflammatory potential, which might modulate the immune response in Chagas' disease. Furthermore, it was possible to demonstrate for the first time that GM-CSF was produced by PBMC of CCC patients in response not only to recombinant ribosomal P proteins but also to parasite lysate, suggesting the value of this cytokine to evaluate T cells responses in T. cruzi infection. PMID

  16. The Tumor Suppressor Protein p53 and its Physiological Splicing Variant p53as in a Mouse Mammary Cancer Model

    DTIC Science & Technology

    1997-10-01

    and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted

  17. Alternative Effector-Function Profiling Identifies Broad HIV-Specific T-Cell Responses in Highly HIV-Exposed Individuals Who Remain Uninfected

    PubMed Central

    Ruiz-Riol, Marta; Llano, Anuska; Ibarrondo, Javier; Zamarreño, Jennifer; Yusim, Karina; Bach, Vanessa; Mothe, Beatriz; Perez-Alvarez, Susana; Fernandez, Marco A.; Requena, Gerard; Meulbroek, Michael; Pujol, Ferran; Leon, Agathe; Cobarsi, Patricia; Korber, Bette T.; Clotet, Bonaventura; Ganoza, Carmela; Sanchez, Jorge; Coll, Josep; Brander, Christian

    2015-01-01

    The characterization of host immune responses to human immunodeficiency virus (HIV) in HIV controllers and individuals with high exposure but seronegativity to HIV (HESN) is needed to guide the development of effective preventive and therapeutic vaccine candidates. However, several technical hurdles severely limit the definition of an effective virus-specific T-cell response. By using a toggle-peptide approach, which takes HIV sequence diversity into account, and a novel, boosted cytokine staining/flow cytometry strategy, we here describe new patterns of T-cell responses to HIV that would be missed by standard assays. Importantly, this approach also allows detection of broad and strong virus-specific T-cell responses in HESN individuals that are characterized by a T-helper type 1 cytokine–like effector profile and produce cytokines that have been associated with potential control of HIV infection, including interleukin 10, interleukin 13, and interleukin 22. These results establish a novel approach to improve the current understanding of HIV-specific T-cell immunity and identify cellular immune responses and individual cytokines as potential markers of relative HIV resistance. As such, the findings also help develop similar strategies for more-comprehensive assessments of host immune responses to other human infections and immune-mediated disorders. PMID:25249264

  18. Data for a proteomic analysis of p53-independent induction of apoptosis by bortezomib

    PubMed Central

    Yerlikaya, Azmi; Okur, Emrah; Tarık Baykal, Ahmet; Acılan, Ceyda; Boyacı, İhsan; Ulukaya, Engin

    2014-01-01

    This data article contains data related to the research article entitled, “A proteomic analysis of p53-independent induction of apoptosis by bortezomib in 4T1 breast cancer cell line” by Yerlikaya et al. [1]. The research article presented 2-DE and nLC-MS/MS based proteomic analysis of proteasome inhibitor bortezomib-induced changes in the expression of cellular proteins. The report showed that GRP78 and TCEB2 were over-expressed in response to treatment with bortezomib for 24 h. In addition, the report demonstrated that Hsp70, the 26S proteasome non-ATPase regulatory subunit 14 and sequestosome 1 were increased at least 2 fold in p53-deficient 4T1 cells. The data here show for the first time the increased expressions of Card10, Dffb, Traf3 and Trp53bp2 in response to inhibition of the 26S proteasome. The information presented here also shows that both Traf1 and Xiap (a member of IAPs) are also downregulated simultaneously upon proteasomal inhibition. The increases in the level of Card10 and Trp53bp2 proteins were verified by Western blot analysis in response to varying concentrations of bortezomib for 24 h. PMID:26217687

  19. CD6 and Linker of Activated T Cells are Potential Interaction Partners for T Cell-Specific Adaptor Protein.

    PubMed

    Hem, C D; Ekornhol, M; Granum, S; Sundvold-Gjerstad, V; Spurkland, A

    2017-02-01

    The T cell-specific adaptor protein (TSAd) contains several protein interaction domains, and is merging as a modulator of T cell activation. Several interaction partners for the TSAd proline-rich region and phosphotyrosines have been identified, including the Src and Tec family kinases lymphocyte-specific protein tyrosine kinase and interleukin 2-inducible T cell kinase. Via its Src homology 2 (SH2) domain, TSAd may thus function as a link between these enzymes and other signalling molecules. However, few binding partners to the TSAd SH2 domain in T cells are hitherto known. Through the use of in silico ligand prediction, peptide spot arrays, pull-down and immunoprecipitation experiments, we here report novel interactions between the TSAd SH2 domain and CD6 phosphotyrosine (pTyr) 629 and linker of activated T cells (LAT) pTyr 171 , pTyr 191 and pTyr 226 . © 2016 The Foundation for the Scandinavian Journal of Immunology.

  20. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    PubMed

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  1. Comprehensive longitudinal analysis of hepatitis C virus (HCV)-specific T cell responses during acute HCV infection in the presence of existing HIV-1 infection.

    PubMed

    van den Berg, C H S B; Ruys, T A; Nanlohy, N M; Geerlings, S E; van der Meer, J T; Mulder, J-W; Lange, J A; van Baarle, D

    2009-04-01

    The aim of this study was to study the development of HCV-specific T cell immunity during acute HCV infection in the presence of an existing HIV-1 infection in four HIV-1 infected men having sex with men. A comprehensive analysis of HCV-specific T cell responses was performed at two time points during acute HCV infection using a T cell expansion assay with overlapping peptide pools spanning the entire HCV genome Three patients with (near) normal CD4+ T cell counts (range 400-970 x 10(6)/L) either resolved (n=1) or temporary suppressed HCV RNA. In contrast, one patient with low CD4+ T cell counts (330 x 10(6)/L), had sustained high HCV RNA levels. All four patients had low HCV-specific CD8+ T cell responses, and similar magnitudes of CD4+ T cell responses. Interestingly, individuals with resolved infection or temporary suppression of HCV-RNA had HCV-specific CD4+ T cell responses predominantly against nonstructural (NS) proteins. While the individual with high HCV RNA plasma concentrations had CD4+ T cell responses predominantly directed against Core. Our data show that an acute HCV infection in an HIV-1 infected person can be suppressed in the presence of HCV-specific CD4+ T cell response targeting non-structural proteins. However further research is needed in a larger group of patients to evaluate the role of HIV-1 on HCV-specific T cell responses in relation to outcome of acute HCV infection.

  2. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    PubMed

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  4. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    PubMed Central

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  5. SIRT1 deacetylase is overexpressed in human melanoma and its small molecule inhibition imparts anti-proliferative response via p53 activation.

    PubMed

    Wilking, Melissa J; Singh, Chandra; Nihal, Minakshi; Zhong, Weixiong; Ahmad, Nihal

    2014-12-01

    Melanoma causes more deaths than any other skin cancer, and its incidence in the US continues to rise. Current medical therapies are insufficient to control this deadly neoplasm, necessitating the development of new target-based approaches. The objective of this study was to determine the role and functional significance of the class III histone deacetylase SIRT1 in melanoma. We have found that SIRT1 is overexpressed in clinical human melanoma tissues and human melanoma cell lines (Sk-Mel-2, WM35, G361, A375, and Hs294T) compared to normal skin and normal melanocytes, respectively. In addition, treatment of melanoma cell lines A375, Hs294T, and G361 with Tenovin-1, a small molecule SIRT1 inhibitor, resulted in a significant decrease in cell growth and cell viability. Further, Tenovin-1 treatment also resulted in a marked decrease in the clonogenic survival of melanoma cells. Further experiments showed that the anti-proliferative response of Tenovin-1 was accompanied by an increase in the protein as well as activity of the tumor suppressor p53. This increase in p53 activity was substantiated by an increase in the protein level of its downstream target p21. Overall, these data suggest that small molecule inhibition of SIRT1 causes anti-proliferative effects in melanoma cells. SIRT1 appears to be acting through the activity of the tumor suppressor p53, which is not mutated in the majority of melanomas. However, future detailed studies are needed to further explore the role and mechanism of SIRT1 in melanoma development and progression and its usefulness in melanoma treatment.

  6. A Synthetic Interaction Screen Identifies Factors Selectively Required for Proliferation and TERT Transcription in p53-Deficient Human Cancer Cells

    PubMed Central

    Park, Sung Mi; Zhu, Lihua J.; Debily, Marie-anne; Kittler, Ellen L. W.; Zapp, Maria L.; Lapointe, David; Gobeil, Stephane; Virbasius, Ching-Man; Green, Michael R.

    2012-01-01

    Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi)–based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53−) human cancer cells. We find that compared to p53-competent (p53+) human cancer cell lines, diverse p53− human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53cells, RNAi–mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53− but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53− cancer cells. PMID:23284306

  7. Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

    PubMed

    Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

    2008-07-01

    We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

  8. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53

    PubMed Central

    York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.

    2016-01-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821

  9. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

    PubMed

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

    2017-09-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  10. Rosiglitazone enhances the radiosensitivity of p53-mutant HT-29 human colorectal cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiu, Shu-Jun, E-mail: chiusj@mail.tcu.edu.tw; Institute of Radiation Sciences, Tzu Chi Technology College, Hualien, Taiwan; Hsaio, Ching-Hui

    2010-04-09

    Combined-modality treatment has improved the outcome in cases of various solid tumors, and radiosensitizers are used to enhance the radiotherapeutic efficiency. Rosiglitazone, a synthetic ligand of peroxisome proliferator-activated receptors {gamma} used in the treatment of type-2 diabetes, has been shown to reduce tumor growth and metastasis in human cancer cells, and may have the potential to be used as a radiosensitizer in radiotherapy for human colorectal cancer cells. In this study, rosiglitazone treatment significantly reduced the cell viability of p53-wild type HCT116 cells but not p53-mutant HT-29 cells. Interestingly, rosiglitazone pretreatment enhanced radiosensitivity in p53-mutant HT-29 cells but not HCT116more » cells, and prolonged radiation-induced G{sub 2}/M arrest and enhanced radiation-induced cell growth inhibition in HT-29 cells. Pretreatment with rosiglitazone also suppressed radiation-induced H2AX phosphorylation in response to DNA damage and AKT activation for cell survival; on the contrary, rosiglitazone pretreatment enhanced radiation-induced caspase-8, -9, and -3 activation and PARP cleavage in HT-29 cells. In addition, pretreatment with a pan-caspase inhibitor, zVAD-fmk, attenuated the levels of caspase-3 activation and PARP cleavage in radiation-exposed cancer cells in combination with rosiglitazone pretreatment. Our results provide proof for the first time that rosiglitazone suppresses radiation-induced survival signals and DNA damage response, and enhances the radiation-induced apoptosis signaling cascade. These findings can assist in the development of rosiglitazone as a novel radiosensitizer.« less

  11. Allogeneic T cell responses are regulated by a specific miRNA-mRNA network

    PubMed Central

    Sun, Yaping; Tawara, Isao; Zhao, Meng; Qin, Zhaohui S.; Toubai, Tomomi; Mathewson, Nathan; Tamaki, Hiroya; Nieves, Evelyn; Chinnaiyan, Arul M.; Reddy, Pavan

    2013-01-01

    Donor T cells that respond to host alloantigens following allogeneic bone marrow transplantation (BMT) induce graft-versus-host (GVH) responses, but their molecular landscape is not well understood. MicroRNAs (miRNAs) regulate gene (mRNA) expression and fine-tune the molecular responses of T cells. We stimulated naive T cells with either allogeneic or nonspecific stimuli and used argonaute cross-linked immunoprecipitation (CLIP) with subsequent ChIP microarray analyses to profile miR responses and their direct mRNA targets. We identified a unique expression pattern of miRs and mRNAs following the allostimulation of T cells and a high correlation between the expression of the identified miRs and a reduction of their mRNA targets. miRs and mRNAs that were predicted to be differentially regulated in allogeneic T cells compared with nonspecifically stimulated T cells were validated in vitro. These analyses identified wings apart-like homolog (Wapal) and synaptojanin 1 (Synj1) as potential regulators of allogeneic T cell responses. The expression of these molecular targets in vivo was confirmed in MHC-mismatched experimental BMT. Targeted silencing of either Wapal or Synj1 prevented the development of GVH response, confirming a role for these regulators in allogeneic T cell responses. Thus, this genome-wide analysis of miRNA-mRNA interactions identifies previously unrecognized molecular regulators of T cell responses. PMID:24216511

  12. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  13. In Vitro Priming of Naı̈ve T-cells with p-Phenylenediamine and Bandrowski's Base.

    PubMed

    Gibson, Andrew; Kim, Seung-Hyun; Faulkner, Lee; Evely, Jane; Pirmohamed, Munir; Park, Kevin B; Naisbitt, Dean J

    2015-10-19

    p-Phenylenediamine (PPD) is a component of hair dye formulations that is associated with T-cell mediated allergic contact dermatitis. Antigen-specific T-cells from allergic contact dermatitis patients are activated with either PPD or the oxidation product, Bandrowski's base. In nonallergic individuals, T-cells that are activated by Bandrowski's base, but not by PPD, are readily detectable. The aim of the current study was to use an in vitro T-cell priming assay to assess the activation of memory and naı̈ve T-cells from healthy donors with PPD and Bandrowski's base, and to compare these responses to those observed from allergic patients. Both PPD and Bandrowski's base-responsive clones were generated from allergic patients. The majority of Bandrowski's base-responsive clones were CD4+ and displayed a lack of PPD reactivity. In contrast, CD4+ and CD8+ clones displaying PPD reactivity were detected. Approximately 25% of these displayed low levels of reactivity to Bandrowski's base. Clones from the allergic patients secreted a range of cytokines including IFN-γ, Il-13, and Il-22. In healthy donors, Bandrowski's base-specific T-cell proliferative responses and cytokine secretion were detected with both naı̈ve and memory T-cells. T-cell clones generated from the Bandrowski's base-responsive cultures responded to Bandrowski's base but not PPD. PPD-specific naı̈ve and memory T-cell responses were not detected from healthy donors. These data show that Bandrowski's base stimulates pre-existing memory T-cells isolated from healthy donors and primes naı̈ve T-cells when the chemical is bound to autologous dendritic cells. Priming naı̈ve T-cells against PPD failed, suggesting an important individual susceptibility factor is missing from the in vitro T-cell priming assay.

  14. Peptide immunisation of HLA-DR-transgenic mice permits the identification of a novel HLA-DRbeta1*0101- and HLA-DRbeta1*0401-restricted epitope from p53.

    PubMed

    Rojas, José Manuel; McArdle, Stephanie E B; Horton, Roger B V; Bell, Matthew; Mian, Shahid; Li, Geng; Ali, Selman A; Rees, Robert C

    2005-03-01

    Because of the central role of CD4(+) T cells in antitumour immunity, the identification of the MHC class II-restricted peptides to which CD4(+) T cells respond has become a priority of tumour immunologists. Here, we describe a strategy permitting us to rapidly determine the immunogenicity of candidate HLA-DR-restricted peptides using peptide immunisation of HLA-DR-transgenic mice, followed by assessment of the response in vitro. This strategy was successfully applied to the reported haemaglutinin influenza peptide HA(307-319), and then extended to three candidate HLA-DR-restricted p53 peptides predicted by the evidence-based algorithm SYFPEITHI to bind to HLA-DRbeta1*0101 (HLA-DR1) and HLA-DRbeta1*0401 (HLA-DR4) molecules. One of these peptides, p53(108-122), consistently induced responses in HLA-DR1- and in HLA-DR4-transgenic mice. Moreover, this peptide was naturally processed by dendritic cells (DCs), and induced specific proliferation in the splenocytes of mice immunised with p53 cDNA, demonstrating that immune responses could be naturally mounted to the peptide. Furthermore, p53(108-122) peptide was also immunogenic in HLA-DR1 and HLA-DR4 healthy donors. Thus, the use of this transgenic model permitted the identification of a novel HLA-DR-restricted epitope from p53 and constitutes an attractive approach for the rapid identification of novel immunogenic MHC class II-restricted peptides from tumour antigens, which can ultimately be incorporated in immunotherapeutic protocols.

  15. Non-Thermal Atmospheric Pressure Plasma Preferentially Induces Apoptosis in p53-Mutated Cancer Cells by Activating ROS Stress-Response Pathways

    PubMed Central

    Ma, Yonghao; Ha, Chang Seung; Hwang, Seok Won; Lee, Hae June; Kim, Gyoo Cheon; Lee, Kyo-Won; Song, Kiwon

    2014-01-01

    Non-thermal atmospheric pressure plasma (NTAPP) is an ionized gas at room temperature and has potential as a new apoptosis-promoting cancer therapy that acts by generating reactive oxygen species (ROS). However, it is imperative to determine its selectivity and standardize the components and composition of NTAPP. Here, we designed an NTAPP-generating apparatus combined with a He gas feeding system and demonstrated its high selectivity toward p53-mutated cancer cells. We first determined the proper conditions for NTAPP exposure to selectively induce apoptosis in cancer cells. The apoptotic effect of NTAPP was greater for p53-mutated cancer cells; artificial p53 expression in p53-negative HT29 cells decreased the pro-apoptotic effect of NTAPP. We also examined extra- and intracellular ROS levels in NTAPP-treated cells to deduce the mechanism of NTAPP action. While NTAPP-mediated increases in extracellular nitric oxide (NO) did not affect cell viability, intracellular ROS increased under NTAPP exposure and induced apoptotic cell death. This effect was dose-dependently reduced following treatment with ROS scavengers. NTAPP induced apoptosis even in doxorubicin-resistant cancer cell lines, demonstrating the feasibility of NTAPP as a potent cancer therapy. Collectively, these results strongly support the potential of NTAPP as a selective anticancer treatment, especially for p53-mutated cancer cells. PMID:24759730

  16. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

    PubMed Central

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-01-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

  17. Novel Pactamycin Analogs Induce p53 Dependent Cell-Cycle Arrest at S-Phase in Human Head and Neck Squamous Cell Carcinoma (HNSCC) Cells

    PubMed Central

    Guha, Gunjan; Liang, Xiaobo; Kulesz-Martin, Molly F.; Mahmud, Taifo; Indra, Arup Kumar; Ganguli-Indra, Gitali

    2015-01-01

    Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and 7-demethyl-7-deoxypactamycin (TM-026), in head and neck squamous cell carcinoma (HNSCC) cell lines SCC25 and SCC104. Both TM-025 and TM-026 exert growth inhibitory effects on HNSCC cells by inhibiting cell proliferation. Interestingly, unlike their parent compound pactamycin, the analogs do not inhibit synthesis of nascent protein in a cell-based assay. Furthermore, they do not induce apoptosis or autophagy in a dose- or a time-dependent manner, but induce mild senescence in the tested cell lines. Cell cycle analysis demonstrated that both analogs significantly induce cell cycle arrest of the HNSCC cells at S-phase resulting in reduced accumulation of G2/M-phase cells. The pactamycin analogs induce expression of cell cycle regulatory proteins including master regulator p53, its downstream target p21Cip1/WAF1, p27kip21, p19, cyclin E, total and phospho Cdc2 (Tyr15) and Cdc25C. Besides, the analogs mildly reduce cyclin D1 expression without affecting expression of cyclin B, Cdk2 and Cdk4. Specific inhibition of p53 by pifithrin-α reduces the percentage of cells accumulated in S-phase, suggesting contribution of p53 to S-phase increase. Altogether, our results demonstrate that Pactamycin analogs TM-025 and TM-026 induce senescence and inhibit proliferation of HNSCC cells via accumulation in S-phase through possible contribution of p53. The two PCT analogs can be widely used as research tools for cell cycle inhibition studies in proliferating cancer cells with specific mechanisms of action. PMID:25938491

  18. CD8+ memory T-cell inflation renders compromised CD4+ T-cell-dependent CD8+ T-cell immunity via naïve T-cell anergy.

    PubMed

    Xu, Aizhang; Freywald, Andrew; Xie, Yufeng; Li, Zejun; Xiang, Jim

    2017-01-01

    Whether inflation of CD8 + memory T (mT) cells, which is often derived from repeated prime-boost vaccinations or chronic viral infections in the elderly, would affect late CD8 + T-cell immunity is a long-standing paradox. We have previously established an animal model with mT-cell inflation by transferring ConA-stimulated monoclonal CD8 + T cells derived from Ova-specific T-cell-receptor transgenic OTI mice into irradiation-induced lymphopenic B6 mice. In this study, we also established another two animal models with mT-cell inflation by transferring, 1) ConA-stimulated monoclonal CD8 + T cells derived from lymphocytic choriomeningitis virus glycoprotein-specific T-cell-receptor transgenic P14 mice, and 2) ConA-stimulated polyclonal CD8 + T cells derived from B6.1 mice into B6 mice with irradiation-induced lymphopenia. We vaccinated these mice with recombinant Ova-expressing Listeria monocytogenes and Ova-pulsed dendritic cells, which stimulated CD4 + T cell-independent and CD4 + T-cell-dependent CD8 + T-cell responses, respectively, and assessed Ova-specific CD8 + T-cell responses by flow cytometry. We found that Ova-specific CD8 + T-cell responses derived from the latter but not the former vaccination were significantly reduced in mice with CD8 + mT-cell inflation compared to wild-type B6 mice. We determined that naïve CD8 + T cells purified from splenocytes of mice with mT-cell inflation had defects in cell proliferation upon stimulation in vitro and in vivo and upregulated T-cell anergy-associated Itch and GRAIL molecules. Taken together, our data reveal that CD8 + mT-cell inflation renders compromised CD4 + T-cell-dependent CD8 + T-cell immunity via naïve T-cell anergy, and thus show promise for the design of efficient vaccines for elderly patients with CD8 + mT-cell inflation.

  19. Vaccination Expands Antigen-Specific CD4+ Memory T Cells and Mobilizes Bystander Central Memory T Cells

    PubMed Central

    Li Causi, Eleonora; Parikh, Suraj C.; Chudley, Lindsey; Layfield, David M.; Ottensmeier, Christian H.; Stevenson, Freda K.; Di Genova, Gianfranco

    2015-01-01

    CD4+ T helper memory (Thmem) cells influence both natural and vaccine-boosted immunity, but mechanisms for their maintenance remain unclear. Pro-survival signals from the common gamma-chain cytokines, in particular IL-7, appear important. Previously we showed in healthy volunteers that a booster vaccination with tetanus toxoid (TT) expanded peripheral blood TT-specific Thmem cells as expected, but was accompanied by parallel increase of Thmem cells specific for two unrelated and non cross-reactive common recall antigens. Here, in a new cohort of healthy human subjects, we compare blood vaccine-specific and bystander Thmem cells in terms of differentiation stage, function, activation and proliferative status. Both responses peaked 1 week post-vaccination. Vaccine-specific cytokine-producing Thmem cells were predominantly effector memory, whereas bystander cells were mainly of central memory phenotype. Importantly, TT-specific Thmem cells were activated (CD38High HLA-DR+), cycling or recently divided (Ki-67+), and apparently vulnerable to death (IL-7RαLow and Bcl-2 Low). In contrast, bystander Thmem cells were resting (CD38Low HLA-DR- Ki-67-) with high expression of IL-7Rα and Bcl-2. These findings allow a clear distinction between vaccine-specific and bystander Thmem cells, suggesting the latter do not derive from recent proliferation but from cells mobilized from as yet undefined reservoirs. Furthermore, they reveal the interdependent dynamics of specific and bystander T-cell responses which will inform assessments of responses to vaccines. PMID:26332995

  20. Induction of specific T helper-9 cells to inhibit glioma cell growth

    PubMed Central

    Zheng, Haiyan; Yang, Baohua; Xu, Dedong; Wang, Wenbo; Tan, Jie; Sun, Liyuan; Li, Qinghua; Sun, Li; Xia, Xuewei

    2017-01-01

    The effects of Staphylococcal enterotoxin B (SEB) on regulation of immune response have been recognized; whether SEB can enhance the effects of immunotherapy on glioma remains to be investigated. This study tests a hypothesis that administration with SEB enhances the effects of specific immunotherapy on glioma growth in mice. In this study, a glioma-bearing mouse model was developed by adoptive transfer with GL261 cells (a mouse glioma cell line). The mice were treated with the GL261 cell extracts (used as an Ag) with or without administration of SEB. We observed that treating glioma-bearing mice with the glioma Ag and SEB induced glioma-specific Th9 cells in both glioma tissue and the spleen. Treating CD4+ CD25− T cells with SEB increased p300 phosphorylation, histone H3K4 acetylation at the interleukin (IL)-9 promoter locus, and increased the IL-9 transcriptional factor binding to the IL-9 promoter. Treating CD4+ CD25− T cells with both SEB and glioma Ag induced glioma-specific Th9 cells. The glioma-specific Th9 cells induced glioma cell apoptosis in the culture. Treating the glioma-bearing mice with SEB and glioma Ag significantly inhibited the glioma growth. In conclusion, SEB plus glioma Ag immunotherapy inhibits the experimental glioma growth, which may be a novel therapeutic remedy for the treatment of glioma. PMID:28002799

  1. miR-338-3p confers 5-fluorouracil resistance in p53 mutant colon cancer cells by targeting the mammalian target of rapamycin.

    PubMed

    Han, Jia; Li, Jie; Tang, Kaijie; Zhang, Huahua; Guo, Bo; Hou, Ni; Huang, Chen

    2017-11-15

    Evidence demonstrate that p53 mutations and microRNAs (miRs) are important components of 5-FU resistance in colorectal cancer (CRC). miR-338-3p has been reported associated with cancer prognosis. However whether or not it influences chemotherapy sensitivity and the underlying mechanisms have not been elucidated. Here, three types of human colon cancer cell lines, HT29 (mutant p53), HCT116 (wild-type p53), and HCT116 p53 -/- (deficient p53), were treated with 5-FU. We showed that expression of miR-338-3p was correlated with apoptosis and 5-FU resistance in colon cancer cells. Ectopic expression of miR-338-3p conferred resistance to 5-FU in HCT116 cells. Further experiments indicated that miR-338-3p mediated 5-FU resistance through down-regulation of mTOR expression. Moreover, inhibition of miR-338-3p in HT29 and HCT116 p53 -/- cells increased their sensitivity to 5-FU treatment. Furthermore, we detected autophagy changes in our experiment because mTOR was known prominently regulating autophagy and the competition between autophagy and apoptosis in response to 5-FU was a mechanism influencing 5-FU sensitivity. Our results reveal a critical and novel role of miR-338-3p in the correlation of 5-FU resistance with p53 status. Moreover, the miR-338-3p inhibitor has the potential to overcome 5-FU resistance in p53 mutant colon cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Strategy for eliciting antigen-specific CD8+ T cell-mediated immune response against a cryptic CTL epitope of merkel cell polyomavirus large T antigen

    PubMed Central

    2012-01-01

    Background Merkel cell carcinoma (MCC) is a relatively new addition to the expanding category of oncovirus-induced cancers. Although still comparably rare, the number of cases has risen dramatically in recent years. Further complicating this trend is that MCC is an extremely aggressive neoplasm with poor patient prognosis and limited treatment options for advanced disease. The causative agent of MCC has been identified as the merkel cell polyomavirus (MCPyV). The MCPyV-encoded large T (LT) antigen is an oncoprotein that is theorized to be essential for virus-mediated tumorigenesis and is therefore, an excellent MCC antigen for the generation of antitumor immune responses. As a foreign antigen, the LT oncoprotein avoids the obstacle of immune tolerance, which normally impedes the development of antitumor immunity. Ergo, it is an excellent target for anti-MCC immunotherapy. Since tumor-specific CD8+ T cells lead to better prognosis for MCC and numerous other cancers, we have generated a DNA vaccine that is capable of eliciting LT-specific CD8+ T cells. The DNA vaccine (pcDNA3-CRT/LT) encodes the LT antigen linked to a damage-associated molecular pattern, calreticulin (CRT), as it has been demonstrated that the linkage of CRT to antigens promotes the induction of antigen-specific CD8+ T cells. Results The present study shows that DNA vaccine-induced generation of LT-specific CD8+ T cells is augmented by linking CRT to the LT antigen. This is relevant since the therapeutic effects of the pcDNA3-CRT/LT DNA vaccine is mediated by LT-specific CD8+ T cells. Mice vaccinated with the DNA vaccine produced demonstrably more LT-specific CD8+ T cells. The DNA vaccine was also able to confer LT-specific CD8+ T cell-mediated protective and therapeutic effects to prolong the survival of mice with LT-expressing tumors. In the interest of determining the LT epitope which most MCC-specific CD8+ T cells recognize, we identified the amino acid sequence of the immunodominant LT epitope

  3. γδ T cells recognize a microbial encoded B cell antigen to initiate a rapid antigen specific Interleukin 17 response

    PubMed Central

    Zeng, Xun; Wei, Yu-ling; Huang, Jun; Newell, Evan W.; Yu, Hongxiang; Kidd, Brian A.; Kuhns, Michael S.; Waters, Ray W.; Davis, Mark M.; Weaver, Casey T.; Chien, Yueh-hsiu

    2012-01-01

    Summary γδ T cells contribute uniquely to host immune defense. However, how they function remains an enigma. Although it is unclear what most γδ T cells recognize, common dogma asserts that they recognize self-antigens. While they are the major initial Interleukin-17 (IL-17) producers in infections, it is unclear what is required to trigger these cells to act. Here, we report that a noted B cell antigen, the algae protein-phycoerythrin (PE) is an antigen for murine and human γδ T cells. PE also stained specific bovine γδ T cells. Employing this specificity, we demonstrated that antigen recognition, but not extensive clonal expansion, was required to activate naïve γδ T cells to make IL-17. In this activated state, γδ T cells gained the ability to respond to cytokine signals that perpetuated the IL-17 production. These results underscore the adaptability of lymphocyte antigen receptors and suggest a previously unrecognized antigen-driven rapid response in protective immunity prior to the maturation of classical adaptive immunity. PMID:22960222

  4. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    PubMed Central

    Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M

    2018-01-01

    Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous

  5. Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.

    PubMed

    Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M

    1995-04-15

    The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic

  6. Wnt-Responsive Cancer Stem Cells Are Located Close to Distorted Blood Vessels and Not in Hypoxic Regions in a p53-Null Mouse Model of Human Breast Cancer

    PubMed Central

    Landua, John D.; Bu, Wen; Wei, Wei; Li, Fuhai; Wong, Stephen T.C.; Dickinson, Mary E.; Rosen, Jeffrey M.; Lewis, Michael T.

    2014-01-01

    Cancer stem cells (CSCs, or tumor-initiating cells) may be responsible for tumor formation in many types of cancer, including breast cancer. Using high-resolution imaging techniques, we analyzed the relationship between a Wnt-responsive, CSC-enriched population and the tumor vasculature using p53-null mouse mammary tumors transduced with a lentiviral Wnt signaling reporter. Consistent with their localization in the normal mammary gland, Wnt-responsive cells in tumors were enriched in the basal/myoepithelial population and generally located in close proximity to blood vessels. The Wnt-responsive CSCs did not colocalize with the hypoxia-inducible factor 1α-positive cells in these p53-null basal-like tumors. Average vessel diameter and vessel tortuosity were increased in p53-null mouse tumors, as well as in a human tumor xenograft as compared with the normal mammary gland. The combined strategy of monitoring the fluorescently labeled CSCs and vasculature using high-resolution imaging techniques provides a unique opportunity to study the CSC and its surrounding vasculature. PMID:24797826

  7. Transforming growth factor-beta inhibits human antigen-specific CD4+ T cell proliferation without modulating the cytokine response.

    PubMed

    Tiemessen, Machteld M; Kunzmann, Steffen; Schmidt-Weber, Carsten B; Garssen, Johan; Bruijnzeel-Koomen, Carla A F M; Knol, Edward F; van Hoffen, Els

    2003-12-01

    Transforming growth factor (TGF)-beta has been demonstrated to play a key role in the regulation of the immune response, mainly by its suppressive function towards cells of the immune system. In humans, the effect of TGF-beta on antigen-specific established memory T cells has not been investigated yet. In this study antigen-specific CD4(+) T cell clones (TCC) were used to determine the effect of TGF-beta on antigen-specific proliferation, the activation status of the T cells and their cytokine production. This study demonstrates that TGF-beta is an adequate suppressor of antigen-specific T cell proliferation, by reducing the cell-cycle rate rather than induction of apoptosis. Addition of TGF-beta resulted in increased CD69 expression and decreased CD25 expression on T cells, indicating that TGF-beta is able to modulate the activation status of in vivo differentiated T cells. On the contrary, the antigen-specific cytokine production was not affected by TGF-beta. Although TGF-beta was suppressive towards the majority of the T cells, insensitivity of a few TCC towards TGF-beta was also observed. This could not be correlated to differential expression of TGF-beta signaling molecules such as Smad3, Smad7, SARA (Smad anchor for receptor activation) and Hgs (hepatocyte growth factor-regulated tyrosine kinase substrate). In summary, TGF-beta has a pronounced inhibitory effect on antigen-specific T cell proliferation without modulating their cytokine production.

  8. C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19(Arf).

    PubMed

    Ewing, S J; Zhu, S; Zhu, F; House, J S; Smart, R C

    2008-11-01

    CCAAT/enhancer-binding protein-beta (C/EBPbeta) is a mediator of cell survival and tumorigenesis. When C/EBPbeta(-/-) mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19(Arf) and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19(Arf) is dramatically elevated in C/EBPbeta(-/-) epidermis and that C/EBPbeta represses a p19(Arf) promoter reporter. To determine whether p19(Arf) is responsible for the proapoptotic phenotype in C/EBPbeta(-/-) mice, C/EBPbeta(-/-);p19(Arf-/-) mice were generated. C/EBPbeta(-/-);p19(Arf-/-) mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19(Arf) is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPbeta(-/-) epidermis, we generated K14-ER:Ras;C/EBPbeta(-/-) mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPbeta(-/-) mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPbeta represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPbeta may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents.

  9. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    PubMed Central

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  10. Genomic Instability Associated with p53 Knockdown in the Generation of Huntington’s Disease Human Induced Pluripotent Stem Cells

    PubMed Central

    Tidball, Andrew M.; Neely, M. Diana; Chamberlin, Reed; Aboud, Asad A.; Kumar, Kevin K.; Han, Bingying; Bryan, Miles R.; Aschner, Michael; Ess, Kevin C.; Bowman, Aaron B.

    2016-01-01

    Alterations in DNA damage response and repair have been observed in Huntington’s disease (HD). We generated induced pluripotent stem cells (iPSC) from primary dermal fibroblasts of 5 patients with HD and 5 control subjects. A significant fraction of the HD iPSC lines had genomic abnormalities as assessed by karyotype analysis, while none of our control lines had detectable genomic abnormalities. We demonstrate a statistically significant increase in genomic instability in HD cells during reprogramming. We also report a significant association with repeat length and severity of this instability. Our karyotypically normal HD iPSCs also have elevated ATM-p53 signaling as shown by elevated levels of phosphorylated p53 and H2AX, indicating either elevated DNA damage or hypersensitive DNA damage signaling in HD iPSCs. Thus, increased DNA damage responses in the HD genotype is coincidental with the observed chromosomal aberrations. We conclude that the disease causing mutation in HD increases the propensity of chromosomal instability relative to control fibroblasts specifically during reprogramming to a pluripotent state by a commonly used episomal-based method that includes p53 knockdown. PMID:26982737

  11. The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression.

    PubMed

    Schramek, Daniel; Kotsinas, Athanassios; Meixner, Arabella; Wada, Teiji; Elling, Ulrich; Pospisilik, J Andrew; Neely, G Gregory; Zwick, Ralf-Harun; Sigl, Verena; Forni, Guido; Serrano, Manuel; Gorgoulis, Vassilis G; Penninger, Josef M

    2011-03-01

    Most preneoplastic lesions are quiescent and do not progress to form overt tumors. It has been proposed that oncogenic stress activates the DNA damage response and the key tumor suppressor p53, which prohibits tumor growth. However, the molecular pathways by which cells sense a premalignant state in vivo are largely unknown. Here we report that tissue-specific inactivation of the stress signaling kinase MKK7 in KRas(G12D)-driven lung carcinomas and NeuT-driven mammary tumors markedly accelerates tumor onset and reduces overall survival. Mechanistically, MKK7 acts through the kinases JNK1 and JNK2, and this signaling pathway directly couples oncogenic and genotoxic stress to the stability of p53, which is required for cell cycle arrest and suppression of epithelial cancers. These results show that MKK7 functions as a major tumor suppressor in lung and mammary cancer in mouse and identify MKK7 as a vital molecular sensor to set a cellular anti-cancer barrier.

  12. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    PubMed Central

    2010-01-01

    Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated

  13. Estradiol agonists inhibit human LoVo colorectal-cancer cell proliferation and migration through p53.

    PubMed

    Hsu, Hsi-Hsien; Kuo, Wei-Wen; Ju, Da-Tong; Yeh, Yu-Lan; Tu, Chuan-Chou; Tsai, Ying-Lan; Shen, Chia-Yao; Chang, Sheng-Huang; Chung, Li-Chin; Huang, Chih-Yang

    2014-11-28

    To investigate the effects of 17β-estradiol via estrogen receptors (ER) or direct administration of ER agonists on human colorectal cancer. LoVo cells were established from the Bioresource Collection and Research Center and cultured in phenol red-free DMEM (Sigma, United States). To investigate the effects of E2 and/or ER selective agonists on cellular proliferation, LoVo colorectal cells were treated with E2 or ER-selective agonists for 24 h and 48 h and subjected to the MTT (Sigma) assay to find the concentration. And investigate the effects of E2 and/or ER selective agonists on cell used western immunoblotting to find out the diversification of signaling pathways. In order to observe motility and migration the wound healing assay and a transwell chamber (Neuro Probe) plate were tased. For a quantitative measure, we counted the number of migrating cells to the wound area post-wounding for 24 h. We further examined the cellular migration-regulating factors urokinase-type plasminogen activator (u-PA), tissue-type plasminogen activator (t-PA) and matrix metalloproteinase (MMP)-9 in human LoVo cells so gelatin zymography that we used and gelatinolytic activity was visualized by Coomassie blue staining. And these results are presented as means ± SE, and statistical comparisons were made using Student's t-test. The structure was first compared with E2 and ER agonists. We then treated the LoVo cells with E2 and ER agonists (10(-8) mol/L) for 24 h and 48 h and subsequently measured the cell viability using MTT assay. Our results showed that treatment with 17β-estradiol and/or ER agonists in human LoVo colorectal cancer cells activated p53 and then up-regulated p21 and p27 protein levels, subsequently inhibiting the downstream target gene, cyclin D1, which regulates cell proliferation. Taken together, our findings demonstrate the anti-tumorigenesis effects of 17β-estradiol and/or ER agonists and suggest that these compounds may prove to be a potential alternative

  14. High frequency electromagnetic fields (GSM signals) affect gene expression levels in tumor suppressor p53-deficient embryonic stem cells.

    PubMed

    Czyz, Jaroslaw; Guan, Kaomei; Zeng, Qinghua; Nikolova, Teodora; Meister, Armin; Schönborn, Frank; Schuderer, Jürgen; Kuster, Niels; Wobus, Anna M

    2004-05-01

    Effects of electromagnetic fields (EMF) simulating exposure to the Global System for Mobile Communications (GSM) signals were studied using pluripotent embryonic stem (ES) cells in vitro. Wild-type ES cells and ES cells deficient for the tumor suppressor p53 were exposed to pulse modulated EMF at 1.71 GHz, lower end of the uplink band of GSM 1800, under standardized and controlled conditions, and transcripts of regulatory genes were analyzed during in vitro differentiation. Two dominant GSM modulation schemes (GSM-217 and GSM-Talk), which generate temporal changes between GSM-Basic (active during talking phases) and GSM-DTX (active during listening phases thus simulating a typical conversation), were applied to the cells at and below the basic safety limits for local exposures as defined for the general public by the International Commission on Nonionizing Radiation Protection (ICNIRP). GSM-217 EMF induced a significant upregulation of mRNA levels of the heat shock protein, hsp70 of p53-deficient ES cells differentiating in vitro, paralleled by a low and transient increase of c-jun, c-myc, and p21 levels in p53-deficient, but not in wild-type cells. No responses were observed in either cell type after EMF exposure to GSM-Talk applied at similar slot-averaged specific absorption rates (SAR), but at lower time-averaged SAR values. Cardiac differentiation and cell cycle characteristics were not affected in embryonic stem and embryonic carcinoma cells after exposure to GSM-217 EMF signals. Our data indicate that the genetic background determines cellular responses to GSM modulated EMF. Bioelectromagnetics 25:296-307, 2004. Copyright 2004 Wiley-Liss, Inc.

  15. Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells.

    PubMed

    Qin, Qingsong; Lauver, Matthew; Maru, Saumya; Lin, Eugene; Lukacher, Aron E

    2017-02-01

    Mouse polyomavirus (MuPyV) causes a smoldering persistent infection in immunocompetent mice. To lower MuPyV infection in acutely and persistently infected mice, and study the impact of a temporal reduction in viral loads on the memory CD8 T cell response, we created a recombinant MuPyV in which a loxP sequence was inserted into the A2 strain genome upstream of the early promoter and another loxP sequence was inserted in cis into the intron shared by all three T antigens. Using mice transgenic for tamoxifen-inducible Cre recombinase, we demonstrated that reduction in MuPyV load during persistent infection was associated with differentiation of virus-specific CD8 T cells having a superior recall response. Evidence presented here supports the concept that reduction in viral load during persistent infection can promote differentiation of protective virus-specific memory CD8 T cells in patients at risk for diseases caused by human polyomaviruses. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Cucurbitacin E Induces G2/M Phase Arrest through STAT3/p53/p21 Signaling and Provokes Apoptosis via Fas/CD95 and Mitochondria-Dependent Pathways in Human Bladder Cancer T24 Cells

    PubMed Central

    Huang, Wen-Wen; Yang, Jai-Sing; Lin, Meng-Wei; Chen, Po-Yuan; Chiou, Shang-Ming; Chueh, Fu-Shin; Lan, Yu-Hsuan; Pai, Shu-Jen; Tsuzuki, Minoru; Ho, Wai-Jane; Chung, Jing-Gung

    2012-01-01

    Cucurbitacin E, a tetracyclic triterpenes compound extracted from cucurbitaceous plants, has been shown to exhibit anticancer and anti-inflammatory activities. The purpose of this study was to elucidate whether cucurbitacin E promotes cell cycle arrest and induces apoptosis in T24 cells and further to explore the underlying molecular mechanisms. The effects of cucurbitacin E on T24 cell's growth and accompanied morphological changes were examined by MTT assay and a phase-contrast microscope. DNA content, mitochondrial membrane potential (ΔΨm) and annexin V/PI staining were determined by flow cytometry. The protein levels were measured by Western blotting. Our results demonstrated that cucurbitacin E-induced G2/M arrest was associated with a marked increase in the levels of p53, p21 and a decrease in phospho-signal transducer and activator of transcription 3 (STAT3), cyclin-dependent kinase 1 (CDK1) and cyclin B. Cucurbitacin E-triggered apoptosis was accompanied with up-regulation of Fas/CD95, truncated BID (t-BID) and a loss of ΔΨm, resulting in the releases of cytochrome c, apoptotic protease activating factor 1 (Apaf-1) and apoptosis-inducing factor (AIF), and sequential activation of caspase-8, caspase-9, and caspase-3. Our findings provided the first evidence that STAT3/p53/p21 signaling, Fas/CD95 and mitochondria-dependent pathways play critical roles in cucurbitacin E-induced G2/M phase arrest and apoptosis of T24 cells. PMID:22272214

  17. Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

    PubMed

    Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

    2001-06-15

    Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

  18. HIV-specific CD8+ T cells: serial killers condemned to die?

    PubMed

    Petrovas, Constantinos; Mueller, Yvonne M; Katsikis, Peter D

    2004-04-01

    An increasing body of evidence supports a key role for cytotoxic CD8+ T cells (CTL) in controlling HIV infection. Although a vigorous HIV-specific CD8+ T cell response is raised during the primary infection, these cells ultimately fail to control virus and prevent disease progression. The failure of CTL to control HIV infection has been attributed to a number of strategies HIV employs to evade the immune system. Recently, intrinsic defects in the CTL themselves have been proposed to contribute to the failure of CTL to control HIV. HIV-specific CD8+ T cells differ in their effector/memory phenotype from other virus-specific CD8+ T cells indicating that their differentiation status differs. This altered differentiation may affect effector functions as well as homing properties of these cells. Other studies have indicated that activation of HIV-specific CTL may be impaired and this contributes to their dysfunction. The effector function of these CTL may also be affected. There are conflicting reports about their ability to kill, whereas IFNgamma production does not appear to be impaired in these cells. In this review we focus on recent work indicating that apoptosis may be an important mechanism through which HIV evades the CTL response. In particular, HIV-specific CD8+ T cells are highly susceptible to CD95/Fas-induced apoptosis. This leads to the hypothesis that virus-specific cytotoxic T cells can be eliminated upon binding CD95L/FasL on HIV-infected cells. Understanding the intrinsic defects of CTL in HIV infection could lead to new therapeutic strategies and optimized vaccination protocols that enhance the HIV-specific cytotoxic response.

  19. Der p 1-pulsed myeloid and plasmacytoid dendritic cells from house dust mite-sensitized allergic patients dysregulate the T cell response.

    PubMed

    Charbonnier, Anne-Sophie; Hammad, Hamida; Gosset, Philippe; Stewart, Geoffrey A; Alkan, Sefik; Tonnel, André-Bernard; Pestel, Joël

    2003-01-01

    Although reports suggest that dendritic cells (DC) are involved in the allergic reaction characterized by a T helper cell type 2 (Th2) profile, the role of myeloid (M-DC) and plasmacytoid DC (P-DC), controlling the balance Th1/Th2, remains unknown. Here, we showed that in Dermatophagoides pteronyssinus (Dpt)-sensitized allergic patients and in healthy donors, M-DC displayed a higher capacity to capture Der p 1, a major allergen of Dpt, than did P-DC. However, Der p 1-pulsed M-DC from healthy subjects overexpressed CD80 and secreted interleukin (IL)-10, whereas M-DC from allergic patients did not. In contrast, with Der p 1-pulsed P-DC from both groups, no increase in human leukocyte antigen-DR, CD80, and CD86 and no IL-10 secretion were detected. When cocultured with allogeneic naive CD4(+) T cells from healthy donors, Der p 1-pulsed M-DC from allergic patients favored a Th1 profile [interferon (IFN)-gamma(high)/IL-4(low)] and Der p 1-pulsed P-DC, a Th2 profile (IFN-gamma(low)/IL-4(high)). In healthy donors, no T cell polarization (IFN-gamma(low)/IL-4(low)) was induced by Der p 1-pulsed M-DC or P-DC, but in response to Der p 1-pulsed M-DC, T cells secreted IL-10. The neutralization of IL-10 produced by Der p 1-pulsed M-DC from healthy donors led to an inhibition of IL-10 production by T cells and a polarization toward a type 1. Thus, IL-10 produced by M-DC might be an essential mediator controlling the balance between tolerance and allergic status. In addition, P-DC could contribute to the steady state in healthy donors or to the development of a Th2 response in allergic donors.

  20. Functional impairment of Tax-specific but not cytomegalovirus-specific CD8+ T lymphocytes in a minor population of asymptomatic human T-cell leukemia virus type 1-carriers

    PubMed Central

    2011-01-01

    Background Human T-cell leukemia virus type 1 (HTLV-1) causes adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) in a small percentage of infected individuals. ATL is often associated with general immune suppression and an impaired HTLV-1-specific T-cell response, an important host defense system. We previously found that a small fraction of asymptomatic HTLV-1-carriers (AC) already showed impaired T-cell responses against the major target antigen, Tax. However, it is unclear whether the impaired HTLV-1 Tax-specific T-cell response in these individuals is an HTLV-1-specific phenomenon, or merely reflects general immune suppression. In this study, in order to characterize the impaired HTLV-1-specific T-cell response, we investigated the function of Tax-specific CD8+ T-cells in various clinical status of HTLV-1 infection. Results By using tetramers consisting of HLA-A*0201, -A*2402, or -A*1101, and corresponding Tax epitope peptides, we detected Tax-specific CD8+ T-cells in the peripheral blood from 87.0% of ACs (n = 20/23) and 100% of HAM/TSP patients (n = 18/18) tested. We also detected Tax-specific CD8+ T-cells in 38.1% of chronic type ATL (cATL) patients (n = 8/21), although its frequencies in peripheral blood CD8+ T cells were significantly lower than those of ACs or HAM/TSP patients. Tax-specific CD8+ T-cells detected in HAM/TSP patients proliferated well in culture and produced IFN-γ when stimulated with Tax peptides. However, such functions were severely impaired in the Tax-specific CD8+ T-cells detected in cATL patients. In ACs, the responses of Tax-specific CD8+ T-cells were retained in most cases. However, we found one AC sample whose Tax-specific CD8+ T-cells hardly produced IFN-γ, and failed to proliferate and express activation (CD69) and degranulation (CD107a) markers in response to Tax peptide. Importantly, the same AC sample contained cytomegalovirus (CMV) pp65-specific CD8+ T-cells that possessed

  1. TP53 status and response to chemotherapy in breast cancer.

    PubMed

    Bertheau, Philippe; Espié, Marc; Turpin, Elisabeth; Lehmann, Jacqueline; Plassa, Louis-François; Varna, Mariana; Janin, Anne; de Thé, Hugues

    2008-01-01

    Despite its central role in the control of apoptosis, senescence and cell cycle arrest, the tumor suppressor protein p53 remains an enigma for its possible role in predicting response to chemotherapy in cancer patients. Many studies remained inconclusive, others showed a better response for tumors with normal p53, and some recent studies showed adverse effects of normal p53 for response to treatment. p53 is not only a powerful pro-apoptotic factor in response to drug-induced DNA damages but also a potential inducer of cell cycle arrest, protecting tumor cells from further cytotoxic damages. Our review describes the classical as well as the more recent concepts. In order to draw definite conclusions, future works should use more reliable methods to assess the TP53 status and should address more homogeneous tumor subpopulations treated with homogeneous chemotherapy regimens. Copyright 2008 S. Karger AG, Basel.

  2. Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

    PubMed Central

    Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

    2016-01-01

    Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

  3. Notch1 Signaling Sensitizes Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Hepatocellular Carcinoma Cells by Inhibiting Akt/Hdm2-mediated p53 Degradation and Up-regulating p53-dependent DR5 Expression*

    PubMed Central

    Wang, Chunmei; Qi, Runzi; Li, Nan; Wang, Zhengxin; An, Huazhang; Zhang, Qinghua; Yu, Yizhi; Cao, Xuetao

    2009-01-01

    Notch signaling plays a critical role in regulating cell proliferation, differentiation, and apoptosis. Our previous study showed that overexpression of Notch1 could inhibit human hepatocellular carcinoma (HCC) cell growth by arresting the cell cycle and inducing apoptosis. HCC cells are resistant to apoptotic induction by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), so new therapeutic approaches have been explored to sensitize HCC cells to TRAIL-induced apoptosis. We are wondering whether and how Notch1 signaling can enhance the sensitivity of HCC cells to TRAIL-induced apoptosis. In this study, we found that overexpression of ICN, the constitutive activated form of Notch1, up-regulated p53 protein expression in HCC cells by inhibiting proteasome degradation. p53 up-regulation was further observed in human primary hepatocellular carcinoma cells after activation of Notch signaling. Inhibition of the Akt/Hdm2 pathway by Notch1 signaling was responsible for the suppression of p53 proteasomal degradation, thus contributing to the Notch1 signaling-mediated up-regulation of p53 expression. Accordingly, Notch1 signaling could make HCC cells more sensitive to TRAIL-induced apoptosis, whereas Notch1 signaling lost the synergistic promotion of TRAIL-induced apoptosis in p53-silenced HepG2 HCC cells and p53-defective Hep3B HCC cells. The data suggest that enhancement of TRAIL-induced apoptosis by Notch1 signaling is dependent upon p53 up-regulation. Furthermore, Notch1 signaling could enhance DR5 expression in a p53-dependent manner. Taken together, Notch1 signaling sensitizes TRAIL-induced apoptosis in HCC cells by inhibiting Akt/Hdm2-mediated p53 degradation and up-regulating p53-dependent DR5 expression. Thus, our results suggest that activation of Notch1 signaling may be a promising approach to improve the therapeutic efficacy of TRAIL-resistant HCC. PMID:19376776

  4. Expression of C-terminal deleted p53 isoforms in neuroblastoma

    PubMed Central

    Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha

    2006-01-01

    The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100

  5. HLA-DR4-associated T and B cell responses to specific determinants on the IA-2 autoantigen in type 1 diabetes.

    PubMed

    McLaughlin, Kerry A; Gulati, Kavita; Richardson, Carolyn C; Morgan, Diana; Bodansky, H Jonathan; Feltbower, Richard G; Christie, Michael R

    2014-11-01

    Autoantibodies to IA-2 in type 1 diabetes are associated with HLA-DR4, suggesting influences of HLA-DR4-restricted T cells on IA-2-specific B cell responses. The aim of this study was to investigate possible T-B cell collaboration by determining whether autoantibodies to IA-2 epitopes are associated with T cell responses to IA-2 peptides presented by DR4. T cells secreting the cytokines IFN-γ and IL-10 in response to seven peptides known to elicit T cell responses in type 1 diabetes were quantified by cytokine ELISPOT in HLA-typed patients characterized for Abs to IA-2 epitopes. T cell responses were detected to all peptides tested, but only IL-10 responses to 841-860 and 853-872 peptides were associated with DR4. Phenotyping by RT-PCR of FACS-sorted CD45RO(hi) T cells secreting IL-10 in response to these two peptides indicated that these expressed GATA-3 or T-bet, but not FOXP3, consistent with these being Th2 or Th1 memory T cells rather than of regulatory phenotype. T cell responses to the same two peptides were also associated with specific Abs: those to 841-860 peptide with Abs to juxtamembrane epitopes, which appear early in prediabetes, and those to peptide 853-872 with Abs to an epitope located in the 831-862 central region of the IA-2 tyrosine phosphatase domain. Abs to juxtamembrane and central region constructs were both DR4 associated. This study identifies a region of focus for B and T cell responses to IA-2 in HLA-DR4 diabetic patients that may explain HLA associations of IA-2 autoantibodies, and this region may provide a target for future immune intervention to prevent disease. Copyright © 2014 by The American Association of Immunologists, Inc.

  6. Interactions between Exosomes from Breast Cancer Cells and Primary Mammary Epithelial Cells Leads to Generation of Reactive Oxygen Species Which Induce DNA Damage Response, Stabilization of p53 and Autophagy in Epithelial Cells

    PubMed Central

    Dutta, Sujoy; Warshall, Case; Bandyopadhyay, Chirosree; Dutta, Dipanjan; Chandran, Bala

    2014-01-01

    Exosomes are nanovesicles originating from multivesicular bodies and are released by all cell types. They contain proteins, lipids, microRNAs, mRNAs and DNA fragments, which act as mediators of intercellular communications by inducing phenotypic changes in recipient cells. Tumor-derived exosomes have been shown to play critical roles in different stages of tumor development and metastasis of almost all types of cancer. One of the ways by which exosomes affect tumorigenesis is to manipulate the tumor microenvironments to create tumor permissive “niches”. Whether breast cancer cell secreted exosomes manipulate epithelial cells of the mammary duct to facilitate tumor development is not known. To address whether and how breast cancer cell secreted exosomes manipulate ductal epithelial cells we studied the interactions between exosomes isolated from conditioned media of 3 different breast cancer cell lines (MDA-MB-231, T47DA18 and MCF7), representing three different types of breast carcinomas, and normal human primary mammary epithelial cells (HMECs). Our studies show that exosomes released by breast cancer cell lines are taken up by HMECs, resulting in the induction of reactive oxygen species (ROS) and autophagy. Inhibition of ROS by N-acetyl-L-cysteine (NAC) led to abrogation of autophagy. HMEC-exosome interactions also induced the phosphorylation of ATM, H2AX and Chk1 indicating the induction of DNA damage repair (DDR) responses. Under these conditions, phosphorylation of p53 at serine 15 was also observed. Both DDR responses and phosphorylation of p53 induced by HMEC-exosome interactions were also inhibited by NAC. Furthermore, exosome induced autophagic HMECs were found to release breast cancer cell growth promoting factors. Taken together, our results suggest novel mechanisms by which breast cancer cell secreted exosomes manipulate HMECs to create a tumor permissive microenvironment. PMID:24831807

  7. Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

    PubMed Central

    Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

    2010-01-01

    Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

  8. Chk1/2 inhibition overcomes the cisplatin resistance of head and neck cancer cells secondary to the loss of functional p53

    PubMed Central

    Gadhikar, Mayur A.; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R.; Osman, Abdullah A.; Neskey, David M.; Zhao, Mei; Fitzgerald, Alison L.; Myers, Jeffrey N.; Frederick, Mitchell J

    2014-01-01

    Despite the use of multimodality therapy employing cisplatin to treat patients with advanced stage head and neck squamous cell carcinoma (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here we show unambiguously that wild type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment while mutation or loss of TP53 is associated with cisplatin resistance. We also demonstrate that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53 null or mutant TP53 cells is due to their lack of senescence. Given the dependence on Chk1/2 kinases to mediate the DNA damage response in p53 deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53 deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report demonstrating the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These pre-clinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53 mutant tumors may be feasible. PMID:23839309

  9. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522; Tooyama, Ikuo

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor ofmore » p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.« less

  10. CARs: Driving T-cell specificity to enhance anti-tumor immunity

    PubMed Central

    Kebriaei, Partow; Kelly, Susan S.; Manuri, Pallavi; Jena, Bipulendu; Jackson, Rineka; Shpall, Elizabeth; Champlin, Richard; Cooper, Laurence J. N.

    2013-01-01

    Adoptive transfer of antigen-specific T cells is a compelling tool to treat cancer. To overcome issues of immune tolerance which limits the endogenous adaptive immune response to tumor-associated antigens, robust systems for the genetic modification and characterization of T cells expressing chimeric antigen receptors (CARs) to redirect specificity have been produced. Refinements with regards to persistence and trafficking of the genetically modified T cells are underway to help improve the potency of genetically modified T cells. Clinical trials utilizing this technology demonstrate feasibility, and increasingly, antitumor activity, paving the way for multi-center trials to establish the efficacy of this novel T-cell therapy. PMID:22202074

  11. Antigen-Specific CD8+ T Cells Fail To Respond to Shigella flexneri ▿

    PubMed Central

    Jehl, Stephanie P.; Doling, Amy M.; Giddings, Kara S.; Phalipon, Armelle; Sansonetti, Philippe J.; Goldberg, Marcia B.; Starnbach, Michael N.

    2011-01-01

    CD8+ T lymphocytes often play a primary role in adaptive immunity to cytosolic microbial pathogens. Surprisingly, CD8+ T cells are not required for protective immunity to the enteric pathogen Shigella flexneri, despite the ability of Shigella to actively secrete proteins into the host cytoplasm, a location from which antigenic peptides are processed for presentation to CD8+ T cells. To determine why CD8+ T cells fail to play a role in adaptive immunity to S. flexneri, we investigated whether antigen-specific CD8+ T cells are primed during infection but are unable to confer protection or, alternatively, whether T cells fail to be primed. To test whether Shigella is capable of stimulating an antigen-specific CD8+ T-cell response, we created an S. flexneri strain that constitutively secretes a viral CD8+ T-cell epitope via the Shigella type III secretion system and characterized the CD8+ T-cell response to this strain both in mice and in cultured cells. Surprisingly, no T cells specific for the viral epitope were stimulated in mice infected with this strain, and cells infected with the recombinant strain were not targeted by epitope-specific T cells. Additionally, we found that the usually robust T-cell response to antigens artificially introduced into the cytoplasm of cultured cells was significantly reduced when the antigen-presenting cell was infected with Shigella. Collectively, these results suggest that antigen-specific CD8+ T cells are not primed during S. flexneri infection and, as a result, afford little protection to the host during primary or subsequent infection. PMID:21357720

  12. A stapled p53 helix overcomes HDMX-mediated suppression of p53.

    PubMed

    Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

    2010-11-16

    Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. Dendritic Cell Immaturity during Infancy Restricts the Capacity To Express Vaccine-Specific T-Cell Memory

    PubMed Central

    Upham, John W.; Rate, Angela; Rowe, Julie; Kusel, Merci; Sly, Peter D.; Holt, Patrick G.

    2006-01-01

    The capacity of the immune system in infants to develop stable T-cell memory in response to vaccination is attenuated, and the mechanism(s) underlying this developmental deficiency in humans is poorly understood. The present study focuses on the capacity for expression of in vitro recall responses to tetanus and diphtheria antigens in lymphocytes from 12-month-old infants vaccinated during the first 6 months of life. We demonstrate that supplementation of infant lymphocytes with “matured” dendritic cells (DC) cultured from autologous CD14+ precursors unmasks previously covert cellular immunity in the form of Th2-skewed cytokine production. Supplementation of adult lymphocytes with comparable prematured autologous DC also boosted vaccine-specific T-cell memory expression, but in contrast to the case for the infants, these cytokine responses were heavily Th1 skewed. Compared to adults, infants had significantly fewer circulating myeloid DC (P < 0.0001) and plasmacytoid DC (P < 0.0001) as a proportion of peripheral blood mononuclear cells. These findings suggest that deficiencies in the numbers of antigen-presenting cells and their functional competence at 12 months of age limit the capacity to express effector memory responses and are potentially a key factor in reduced vaccine responsiveness in infants. PMID:16428758

  14. Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

    PubMed Central

    Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

    2016-01-01

    Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

  15. Anti-inflammatory activity of chloroquine and amodiaquine through p21-mediated suppression of T cell proliferation and Th1 cell differentiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oh, Sera; Shin, Ji Hyun; Jang, Eun Jung

    Chloroquine (CQ) and amodiaquine (AQ) have been used for treating or preventing malaria for decades, and their application has expanded into treating inflammatory disease in humans. CQ and AQ are applicable for controlling rheumatoid arthritis, but their molecular mechanisms of anti-inflammatory activity remain to be elucidated. In this study, we examined the effects of CQ and AQ on T cell activation and T cell-mediated immune response. CQ had no significant effect on T cell numbers, but decreased the population of T cells with a high division rate. However, AQ treatment significantly increased the number of cells with low division ratesmore » and eliminated cells with high division rates, resulting in the inhibition of T cell proliferation triggered by T cell receptor stimulation, of which inhibition occurred in developing effector T helper and regulatory T cells, regardless of the different exogenous cytokines. Interestingly, the cyclin-dependent kinase inhibitor p21 was significantly and dose-dependently increased by CQ, and more potently by AQ, while other cell cycle regulators were unchanged. Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus. Sustained treatment of developing T cells with either CQ or AQ suppressed IFN-γ production in a dose dependent manner and potently inhibited the differentiation of IFN-γ-producing Th1 cells. These results demonstrate that CQ and AQ increase the expression level of p21 and inhibit T cell proliferation and the development of IFN-γ-producing Th1 cells, thereby revealing beneficial roles in treating a wide range of chronic inflammatory diseases mediated by inflammatory T cells. -- Highlights: •T cell division rates are suppressed by chloroquine and amodiaquine treatment. •Chloroquine and amodiaquine potently increased the p21 expression. •The p21

  16. Group 3 innate lymphoid cells mediate intestinal selection of commensal bacteria-specific CD4+ T cells

    PubMed Central

    Hepworth, Matthew R.; Fung, Thomas C.; Masur, Samuel H.; Kelsen, Judith R.; McConnell, Fiona M.; Dubrot, Juan; Withers, David R.; Hugues, Stephanie; Farrar, Michael A.; Reith, Walter; Eberl, Gerard; Baldassano, Robert N.; Laufer, Terri M.; Elson, Charles O.; Sonnenberg, Gregory F.

    2015-01-01

    Inflammatory CD4+ T cell responses to self or commensal bacteria underlie the pathogenesis of autoimmunity and inflammatory bowel disease (IBD), respectively. While selection of self-specific T cells in the thymus limits responses to tissue antigens, the mechanisms that control selection of commensal bacteria-specific T cells remain poorly understood. Here we demonstrate that group 3 innate lymphoid cell (ILC3)-intrinsic expression of major histocompatibility complex class II (MHCII) is regulated similarly to thymic epithelial cells, and that MHCII+ ILC3s directly induce cell death of activated commensal bacteria-specific T cells. Further, MHCII on human colonic ILC3s was reduced in pediatric IBD patients. Collectively, these results define a selection pathway for commensal bacteria-specific CD4+ T cells in the intestine, and suggest that this process is dysregulated in human IBD. PMID:25908663

  17. C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

    PubMed Central

    Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

    2013-01-01

    CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

  18. Tolerogenic effect of mesenchymal stromal cells on gliadin-specific T lymphocytes in celiac disease.

    PubMed

    Ciccocioppo, Rachele; Camarca, Alessandra; Cangemi, Giuseppina Cristina; Radano, Giorgia; Vitale, Serena; Betti, Elena; Ferrari, Davide; Visai, Livia; Strada, Elena; Badulli, Carla; Locatelli, Franco; Klersy, Catherine; Gianfrani, Carmen; Corazza, Gino Roberto

    2014-08-01

    Celiac disease is caused by a dysregulated immune response toward dietary gluten, whose only treatment is a lifelong gluten-free diet. We investigated the effects of mesenchymal stromal cells (MSCs) on gliadin-specific T cells, which are known to induce intestinal lesions, in view of a possible use as new therapy. Bone marrow-derived MSCs and gliadin-specific T-cell lines were obtained from allogeneic donors and mucosal specimens of celiac patients, respectively. The immunosuppressant effect of MSCs was evaluated in terms of proliferative response and interferon (IFN)-γ production upon gliadin stimulation of long-term T-cell lines; the immunomodulant effect was assessed in terms of apoptotic rate, immunophenotype and cytokine profile of short-term T-cell lines generated in the presence of MSCs. Different MSC:T-cell ratios were applied, and statistics were performed as appropriate. MSCs inhibited both proliferative response and IFN-γ production of long-term T-cell lines in a dose-dependent manner while limiting the expansion of short-term T-cell lines by increasing the apoptotic rate. Moreover, a reduction of the CD4(+) population and expansion of the regulatory FoxP3+ subset were found in T-cell lines cultured with MSCs, in which a significant decrease of interleukin (IL)-21, IFN-γ and IL-10 paralleled by an upregulation of transforming growth factor-β1, IL-6 and IL-8 were observed. Finally, an increase of the indoleamine 2,3-dioxygenase activity was found, possibly playing a key role in mediating these effects. MSCs exert potent immunomodulant effects on gliadin-specific T cells, which may be exploited for future therapeutic application in celiac disease. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  19. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis.

    PubMed

    Napoletano, Francesco; Gibert, Benjamin; Yacobi-Sharon, Keren; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Teil, Margaux; Chatelain, Gilles; Walter, Ludivine; Arama, Eli; Mollereau, Bertrand

    2017-09-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis.

  20. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis

    PubMed Central

    Napoletano, Francesco; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Chatelain, Gilles; Walter, Ludivine; Arama, Eli

    2017-01-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis. PMID:28945745

  1. A novel natural killer cell line (KHYG-1) from a patient with aggressive natural killer cell leukemia carrying a p53 point mutation.

    PubMed

    Yagita, M; Huang, C L; Umehara, H; Matsuo, Y; Tabata, R; Miyake, M; Konaka, Y; Takatsuki, K

    2000-05-01

    We present the establishment of a natural killer (NK) leukemia cell line, designated KHYG-1, from the blood of a patient with aggressive NK leukemia, which both possessed the same p53 point mutation. The immunophenotype of the primary leukemia cells was CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16+, CD56+, CD57+ and HLA-DR+. A new cell line (KHYG-1) was established by culturing peripheral leukemia cells with 100 units of recombinant interleukin (IL)-2. The KHYG-1 cells showed LGL morphology with a large nucleus, coarse chromatin, conspicuous nucleoli, and abundant basophilic cytoplasm with many azurophilic granules. The immunophenotype of KHYG-1 cells was CD1-, CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16-, CD25-, CD33+, CD34-, CD56+, CD57-, CD122+, CD132+, and TdT-. Southern blot analysis of these cells revealed a normal germline configuration for the beta, delta, and gamma chains of the T cell receptor and the immunoglobulin heavy-chain genes. Moreover, the KHYG-1 cells displayed NK cell activity and IL-2-dependent proliferation in vitro, suggesting that they are of NK cell origin. Epstein-Barr virus (EBV) DNA was not detected in KHYG-1 cells by Southern blot analysis with a terminal repeat probe from an EBV genome. A point mutation in exon 7 of the p53 gene was detected in the KHYG-1 cells by PCR/SSCP analysis, and direct sequencing revealed the conversion of C to T at nucleotide 877 in codon 248. The primary leukemia cells also carried the same point mutation. Although the precise role of the p53 point mutation in leukemogenesis remains to be clarified, the establishment of an NK leukemia cell line with a p53 point mutation could be valuable in the study of leukemogenesis.

  2. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

    PubMed

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-09-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

  3. Predominant role of DNA polymerase eta and p53-dependent translesion synthesis in the survival of ultraviolet-irradiated human cells.

    PubMed

    Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M

    2017-02-17

    Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Modelling and Simulation of the Dynamics of the Antigen-Specific T Cell Response Using Variable Structure Control Theory.

    PubMed

    Anelone, Anet J N; Spurgeon, Sarah K

    2016-01-01

    Experimental and mathematical studies in immunology have revealed that the dynamics of the programmed T cell response to vigorous infection can be conveniently modelled using a sigmoidal or a discontinuous immune response function. This paper hypothesizes strong synergies between this existing work and the dynamical behaviour of engineering systems with a variable structure control (VSC) law. These findings motivate the interpretation of the immune system as a variable structure control system. It is shown that dynamical properties as well as conditions to analytically assess the transition from health to disease can be developed for the specific T cell response from the theory of variable structure control. In particular, it is shown that the robustness properties of the specific T cell response as observed in experiments can be explained analytically using a VSC perspective. Further, the predictive capacity of the VSC framework to determine the T cell help required to overcome chronic Lymphocytic Choriomeningitis Virus (LCMV) infection is demonstrated. The findings demonstrate that studying the immune system using variable structure control theory provides a new framework for evaluating immunological dynamics and experimental observations. A modelling and simulation tool results with predictive capacity to determine how to modify the immune response to achieve healthy outcomes which may have application in drug development and vaccine design.

  5. CD4+ T-Cell-Independent Secondary Immune Responses to Pneumocystis Pneumonia

    PubMed Central

    de la Rua, Nicholas M.; Samuelson, Derrick R.; Charles, Tysheena P.; Welsh, David A.; Shellito, Judd E.

    2016-01-01

    Pneumocystis pneumonia is a major cause of morbidity and mortality among immunocompromised patients, especially in the context of HIV/AIDS. In the murine model of Pneumocystis pneumonia, CD4+ T-cells are required for clearance of a primary infection of Pneumocystis, but not the memory recall response. We hypothesized that the memory recall response in the absence of CD4+ T-cells is mediated by a robust memory humoral response, CD8+ T-cells, and IgG-mediated phagocytosis by alveolar macrophages. To investigate the role of CD8+ T-cells and alveolar macrophages in the immune memory response to Pneumocystis, mice previously challenged with Pneumocystis were depleted of CD8+ T-cells or alveolar macrophages prior to re-infection. Mice depleted of CD4+ T-cells prior to secondary challenge cleared Pneumocystis infection within 48 h identical to immunocompetent mice during a secondary memory recall response. However, loss of CD8+ T-cells or macrophages prior to the memory recall response significantly impaired Pneumocystis clearance. Specifically, mice depleted of CD8+ T-cells or alveolar macrophages had significantly higher fungal burden in the lungs. Furthermore, loss of alveolar macrophages significantly skewed the lung CD8+ T-cell response toward a terminally differentiated effector memory population and increased the percentage of IFN-γ+ CD8+ T-cells. Finally, Pneumocystis-infected animals produced significantly more bone marrow plasma cells and Pneumocystis-specific IgG significantly increased macrophage-mediated killing of Pneumocystis in vitro. These data suggest that secondary immune memory responses to Pneumocystis are mediated, in part, by CD8+ T-cells, alveolar macrophages, and the production of Pneumocystis-specific IgG. PMID:27242785

  6. Statistical Physics of T-Cell Development and Pathogen Specificity

    NASA Astrophysics Data System (ADS)

    Košmrlj, Andrej; Kardar, Mehran; Chakraborty, Arup K.

    2013-04-01

    In addition to an innate immune system that battles pathogens in a nonspecific fashion, higher organisms, such as humans, possess an adaptive immune system to combat diverse (and evolving) microbial pathogens. Remarkably, the adaptive immune system mounts pathogen-specific responses, which can be recalled upon reinfection with the same pathogen. It is difficult to see how the adaptive immune system can be preprogrammed to respond specifically to a vast and unknown set of pathogens. Although major advances have been made in understanding pertinent molecular and cellular phenomena, the precise principles that govern many aspects of an immune response are largely unknown. We discuss complementary approaches from statistical mechanics and cell biology that can shed light on how key components of the adaptive immune system, T cells, develop to enable pathogen-specific responses against many diverse pathogens. The mechanistic understanding that emerges has implications for how host genetics may influence the development of T cells with differing responses to the human immunodeficiency virus (HIV) infection.

  7. The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

    PubMed Central

    Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

    2014-01-01

    Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

  8. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling

  9. miR-300 regulates cellular radiosensitivity through targeting p53 and apaf1 in human lung cancer cells.

    PubMed

    He, Jinpeng; Feng, Xiu; Hua, Junrui; Wei, Li; Lu, Zhiwei; Wei, Wenjun; Cai, Hui; Wang, Bing; Shi, Wengui; Ding, Nan; Li, He; Zhang, Yanan; Wang, Jufang

    2017-10-18

    microRNAs (miRNAs) play a crucial role in mediation of the cellular sensitivity to ionizing radiation (IR). Previous studies revealed that miR-300 was involved in the cellular response to IR or chemotherapy drug. However, whether miR-300 could regulate the DNA damage responses induced by extrinsic genotoxic stress in human lung cancer and the underlying mechanism remain unknown. In this study, the expression of miR-300 was examined in lung cancer cells treated with IR, and the effects of miR-300 on DNA damage repair, cell cycle arrest, apoptosis and senescence induced by IR were investigated. It was found that IR induced upregulation of endogenous miR-300, and ectopic expression of miR-300 by transfected with miR-300 mimics not only greatly enhanced the cellular DNA damage repair ability but also substantially abrogated the G2 cell cycle arrest and apoptosis induced by IR. Bioinformatic analysis predicted that p53 and apaf1 were potential targets of miR-300, and the luciferase reporter assay showed that miR-300 significantly suppressed the luciferase activity through binding to the 3'-UTR of p53 or apaf1 mRNA. In addition, overexpression of miR-300 significantly reduced p53/apaf1 and/or IR-induced p53/apaf1 protein expression levels. Flow cytomertry analysis and colony formation assay showed that miR-300 desensitized lung cancer cells to IR by suppressing p53-dependent G2 cell cycle arrest, apoptosis and senescence. These data demonstrate that miR-300 regulates the cellular sensitivity to IR through targeting p53 and apaf1 in lung cancer cells.

  10. PML is a ROS sensor activating p53 upon oxidative stress

    PubMed Central

    Soilihi, Hassane

    2017-01-01

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

  11. PML is a ROS sensor activating p53 upon oxidative stress.

    PubMed

    Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

    2017-11-06

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

  12. Influenza-specific T cells from older people are enriched in the late effector subset and their presence inversely correlates with vaccine response.

    PubMed

    Wagar, Lisa E; Gentleman, Beth; Pircher, Hanspeter; McElhaney, Janet E; Watts, Tania H

    2011-01-01

    T cells specific for persistent pathogens accumulate with age and express markers of immune senescence. In contrast, much less is known about the state of T cell memory for acutely infecting pathogens. Here we examined T cell responses to influenza in human peripheral blood mononuclear cells from older (>64) and younger (<40) donors using whole virus restimulation with influenza A (A/PR8/34) ex vivo. Although most donors had pre-existing influenza reactive T cells as measured by IFNγ production, older donors had smaller populations of influenza-responsive T cells than young controls and had lost a significant proportion of their CD45RA-negative functional memory population. Despite this apparent dysfunction in a proportion of the older T cells, both old and young donors' T cells from 2008 could respond to A/California/07/2009 ex vivo. For HLA-A2+ donors, MHC tetramer staining showed that a higher proportion of influenza-specific memory CD8 T cells from the 65+ group co-express the markers killer cell lectin-like receptor G1 (KLRG1) and CD57 compared to their younger counterparts. These markers have previously been associated with a late differentiation state or immune senescence. Thus, memory CD8 T cells to an acutely infecting pathogen show signs of advanced differentiation and functional deterioration with age. There was a significant negative correlation between the frequency of KLRG1(+)CD57(+) influenza M1-specific CD8 T cells pre-vaccination and the ability to make antibodies in response to vaccination with seasonal trivalent inactivated vaccine, whereas no such trend was observed when the total CD8(+)KLRG1(+)CD57(+) population was analyzed. These results suggest that the state of the influenza-specific memory CD8 T cells may be a predictive indicator of a vaccine responsive healthy immune system in old age.

  13. Public clonotype usage identifies protective Gag-specific CD8+ T cell responses in SIV infection

    PubMed Central

    Asher, Tedi E.; Wilson, Nancy A.; Nason, Martha C.; Brenchley, Jason M.; Metzler, Ian S.; Venturi, Vanessa; Gostick, Emma; Chattopadhyay, Pratip K.; Roederer, Mario; Davenport, Miles P.; Watkins, David I.; Douek, Daniel C.

    2009-01-01

    Despite the pressing need for an AIDS vaccine, the determinants of protective immunity to HIV remain concealed within the complexity of adaptive immune responses. We dissected immunodominant virus-specific CD8+ T cell populations in Mamu-A*01+ rhesus macaques with primary SIV infection to elucidate the hallmarks of effective immunity at the level of individual constituent clonotypes, which were identified according to the expression of distinct T cell receptors (TCRs). The number of public clonotypes, defined as those that expressed identical TCR β-chain amino acid sequences and recurred in multiple individuals, contained within the acute phase CD8+ T cell population specific for the biologically constrained Gag CM9 (CTPYDINQM; residues 181–189) epitope correlated negatively with the virus load set point. This independent molecular signature of protection was confirmed in a prospective vaccine trial, in which clonotype engagement was governed by the nature of the antigen rather than the context of exposure and public clonotype usage was associated with enhanced recognition of epitope variants. Thus, the pattern of antigen-specific clonotype recruitment within a protective CD8+ T cell population is a prognostic indicator of vaccine efficacy and biological outcome in an AIDS virus infection. PMID:19349463

  14. Pleurotus ostreatus inhibits proliferation of human breast and colon cancer cells through p53-dependent as well as p53-independent pathway

    PubMed Central

    JEDINAK, ANDREJ; SLIVA, DANIEL

    2009-01-01

    In spite of the global consumption of mushrooms, only two epidemiological studies demonstrated an inverse correlation between mushroom intake and the risk of cancer. Therefore, in the present study we evaluated whether extracts from edible mushrooms Agaricus bisporus (portabella), Flammulina velutipes (enoki), Lentinula edodes (shiitake) and Pleurotus ostreatus (oyster) affect the growth of breast and colon cancer cells. Here, we identified as the most potent, P. ostreatus (oyster mushroom) which suppressed proliferation of breast cancer (MCF-7, MDA-MB-231) and colon cancer (HT-29, HCT-116) cells, without affecting proliferation of epithelial mammary MCF-10A and normal colon FHC cells. Flow cytometry revealed that the inhibition of cell proliferation by P. ostreatus was associated with the cell cycle arrest at G0/G1 phase in MCF-7 and HT-29 cells. Moreover, P. ostreatus induced the expression of the tumor suppressor p53 and cyclin-dependent kinase inhibitor p21(CIP1/WAF1), whereas inhibited the phosphorylation of retinoblastoma Rb protein in MCF-7 cells. In addition, P. ostreatus also up-regulated expression of p21 and inhibited Rb phosphorylation in HT-29 cells, suggesting that that P. ostreatus suppresses the proliferation of breast and colon cancer cells via p53-dependent as well as p53-independent pathway. In conclusion, our results indicated that the edible oyster mushroom has potential therapeutic/preventive effects on breast and colon cancer. PMID:19020765

  15. Stimulation of autophagy by the p53 target gene Sestrin2.

    PubMed

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  16. Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

    Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

  17. A Novel ATM/TP53/p21-Mediated Checkpoint Only Activated by Chronic γ-Irradiation

    PubMed Central

    Sasatani, Megumi; Iizuka, Daisuke; Masuda, Yuji; Inaba, Toshiya; Suzuki, Keiji; Ootsuyama, Akira; Umata, Toshiyuki; Kamiya, Kenji; Suzuki, Fumio

    2014-01-01

    Different levels or types of DNA damage activate distinct signaling pathways that elicit various cellular responses, including cell-cycle arrest, DNA repair, senescence, and apoptosis. Whereas a range of DNA-damage responses have been characterized, mechanisms underlying subsequent cell-fate decision remain elusive. Here we exposed cultured cells and mice to different doses and dose rates of γ-irradiation, which revealed cell-type-specific sensitivities to chronic, but not acute, γ-irradiation. Among tested cell types, human fibroblasts were associated with the highest levels of growth inhibition in response to chronic γ-irradiation. In this context, fibroblasts exhibited a reversible G1 cell-cycle arrest or an irreversible senescence-like growth arrest, depending on the irradiation dose rate or the rate of DNA damage. Remarkably, when the same dose of γ-irradiation was delivered chronically or acutely, chronic delivery induced considerably more cellular senescence. A similar effect was observed with primary cells isolated from irradiated mice. We demonstrate a critical role for the ataxia telangiectasia mutated (ATM)/tumor protein p53 (TP53)/p21 pathway in regulating DNA-damage-associated cell fate. Indeed, blocking the ATM/TP53/p21 pathway deregulated DNA damage responses, leading to micronucleus formation in chronically irradiated cells. Together these results provide insights into the mechanisms governing cell-fate determination in response to different rates of DNA damage. PMID:25093836

  18. Concordant p53 and mdm-2 protein expression in vulvar squamous cell carcinoma and adjacent lichen sclerosus.

    PubMed

    Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S

    2001-06-01

    To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar

  19. IL-1 enhances expansion, effector function, tissue localization, and memory response of antigen-specific CD8 T cells

    PubMed Central

    Ben-Sasson, Shlomo Z.; Hogg, Alison; Hu-Li, Jane; Wingfield, Paul; Chen, Xi; Crank, Michelle; Caucheteux, Stephane; Ratner-Hurevich, Maya; Berzofsky, Jay A.; Nir-Paz, Ran

    2013-01-01

    Here, we show that interleukin-1 (IL-1) enhances antigen-driven CD8 T cell responses. When administered to recipients of OT-I T cell receptor transgenic CD8 T cells specific for an ovalbumin (OVA) peptide, IL-1 results in an increase in the numbers of wild-type but not IL1R1−/− OT-I cells, particularly in spleen, liver, and lung, upon immunization with OVA and lipopolysaccharide. IL-1 administration also results in an enhancement in the frequency of antigen-specific cells that are granzyme B+, have cytotoxic activity, and/ or produce interferon γ (IFN-γ). Cells primed in the presence of IL-1 display enhanced expression of granzyme B and increased capacity to produce IFN-γ when rechallenged 2 mo after priming. In three in vivo models, IL-1 enhances the protective value of weak immunogens. Thus, IL-1 has a marked enhancing effect on antigen-specific CD8 T cell expansion, differentiation, migration to the periphery, and memory. PMID:23460726

  20. Nicotine induces cell proliferation in association with cyclin D1 up-regulation and inhibits cell differentiation in association with p53 regulation in a murine pre-osteoblastic cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sato, Tsuyoshi; Abe, Takahiro; Nakamoto, Norimichi

    Recent studies have suggested that nicotine critically affects bone metabolism. Many studies have examined the effects of nicotine on proliferation and differentiation, but the underlying molecular mechanisms remain unclear. We examined cell cycle regulators involved in the proliferation and differentiation of MC3T3-E1 cells. Nicotine induced cell proliferation in association with p53 down-regulation and cyclin D1 up-regulation. In differentiated cells, nicotine reduced alkaline phosphatase activity and mineralized nodule formation in dose-dependent manners. Furthermore, p53 expression was sustained in nicotine-treated cells during differentiation. These findings indicate that nicotine promotes the cell cycle and inhibits differentiation in association with p53 regulation in pre-osteoblasticmore » cells.« less

  1. Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

    PubMed Central

    Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

    2017-01-01

    In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

  2. CD4 and CD8 T-Cell Responses to Mycobacterial Antigens in African Children

    PubMed Central

    Tena-Coki, Nontobeko G.; Scriba, Thomas J.; Peteni, Nomathemba; Eley, Brian; Wilkinson, Robert J.; Andersen, Peter; Hanekom, Willem A.; Kampmann, Beate

    2010-01-01

    Rationale: The current tuberculosis (TB) vaccine, bacille Calmette-Guérin (BCG), does not provide adequate protection against TB disease in children. Furthermore, more efficacious TB vaccines are needed for children with immunodeficiencies such as HIV infection, who are at highest risk of disease. Objectives: To characterize mycobacteria-specific T cells in children who might benefit from vaccination against TB, focusing on responses to antigens contained in novel TB vaccines. Methods: Whole blood was collected from three groups of BCG-vaccinated children: HIV-seronegative children receiving TB treatment (n = 30), HIV-infected children (n = 30), and HIV-unexposed healthy children (n = 30). Blood was stimulated with Ag85B and TB10.4, or purified protein derivative, and T-cell cytokine production by CD4 and CD8 was determined by flow cytometry. The memory phenotype of antigen-specific CD4 and CD8 T cells was also determined. Measurements and Main Results: Mycobacteria-specific CD4 and CD8 T-cell responses were detectable in all three groups of children. Children receiving TB treatment had significantly higher frequencies of antigen-specific CD4 T cells compared with HIV-infected children (P = 0.0176). No significant differences in magnitude, function, or phenotype of specific T cells were observed in HIV-infected children compared with healthy control subjects. CD4 T cells expressing IFN-γ, IL-2, or both expressed a CD45RA−CCR7−CD27+/− effector memory phenotype. Mycobacteria-specific CD8 T cells expressed mostly IFN-γ in all groups of children; these cells expressed CD45RA−CCR7−CD27+/− or CD45RA+CCR7−CD27+/− effector memory phenotypes. Conclusions: Mycobacteria-specific T-cell responses could be demonstrated in all groups of children, suggesting that the responses could be boosted by new TB vaccines currently in clinical trials. PMID:20224065

  3. Development of an adenoviral vector with robust expression driven by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

  4. The polyomavirus BK large T-antigen-derived peptide elicits an HLA-DR promiscuous and polyfunctional CD4+ T-cell response.

    PubMed

    Ramaswami, Bala; Popescu, Iulia; Macedo, Camila; Luo, Chunqing; Shapiro, Ron; Metes, Diana; Chalasani, Geetha; Randhawa, Parmjeet S

    2011-05-01

    BK virus (BKV) nephropathy and hemorrhagic cystitis are increasingly recognized causes of disease in renal and hematopoietic stem cell transplant recipients, respectively. Functional characterization of the immune response to BKV is important for clinical diagnosis, prognosis, and vaccine design. A peptide mix (PepMix) and overlapping (OPP) or random (RPP) peptide pools derived from BKV large T antigen (LTA) were used to restimulate 14-day-expanded peripheral blood mononuclear cells (PBMC) from 27 healthy control subjects in gamma interferon (IFN-γ)-specific enzyme-linked immunospot (ELISPOT) assays. A T-cell response to LTA PepMix was detected in 15/27 subjects. A response was frequently observed with peptides derived from the helicase domain (9/15 subjects), while the DNA binding and host range domains were immunologically inert (0/15 subjects). For all nine subjects who responded to LTA peptide pools, the immune response could be explained largely by a 15-mer peptide designated P313. P313-specific CD4(+) T-cell clones demonstrated (i) stringent LTA peptide specificity; (ii) promiscuous recognition in the context of HLA-DR alleles; (iii) cross recognition of homologous peptides from the polyomavirus simian virus 40 (SV40); (iv) an effector memory phenotype, CD107a expression, and intracellular production of IFN-γ and tumor necrosis factor alpha (TNF-α); (v) cytotoxic activity in a chromium release assay; and (vi) the ability to directly present cognate antigen to autologous T cells. In conclusion, T-cell-mediated immunity to BKV in healthy subjects is associated with a polyfunctional population of CD4(+) T cells with dual T-helper and T-cytotoxic properties. HLA class II promiscuity in antigen presentation makes the targeted LTA peptide sequence a suitable candidate for inclusion in immunotherapy protocols.

  5. Circulating rotavirus-specific T cells have a poor functional profile

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parra, Miguel; Herrera, Daniel; Jácome, María Fernanda

    Frequencies of circulating T cells producing IFN-γ, TNF-α, and IL-2, and percentages of T cells proliferating after stimulation with rotavirus (RV), tetanus toxoid, and influenza were evaluated in PBMC derived from healthy adults and children. In addition, the potential anergic state of RV-specific T cells was analyzed by stimulation of PBMC with RV antigen in the presence of three anergy inhibitors (rIL-2, rIL-12, or DGKα-i). The quality and magnitude of RV-T cell responses were significantly lower than those of tetanus toxoid and influenza antigens. RV-CD4 T cell response was enriched in monofunctional IFN-γ{sup +} cells, while influenza-CD4 and tetanus toxoid-CD4more » T cell responses were enriched in multifunctional T cells. Moreover, rIL-2 – unlike rIL-12 or DGKα-i – increased the frequencies of RV-CD4 TNF-α{sup +}, CD4 IFN-γ{sup +}, and CD8 IFN-γ{sup +} cells. Thus, circulating RV-T cells seem to have a relatively poor functional profile that may be partially reversed in vitro by the addition of rIL-2. - Highlights: • The quality and magnitude of circulating RV-T cell responses are relatively poor. • Circulating RV-CD4 T cells are enriched in monofunctional IFN-γ+ cells. • Treatment with rIL-2 increased the frequencies of cytokine secreting RV-T cells.« less

  6. Precision cancer immunotherapy: optimizing dendritic cell-based strategies to induce tumor antigen-specific T-cell responses against individual patient tumors.

    PubMed

    Osada, Takuya; Nagaoka, Koji; Takahara, Masashi; Yang, Xiao Yi; Liu, Cong-Xiao; Guo, Hongtao; Roy Choudhury, Kingshuk; Hobeika, Amy; Hartman, Zachary; Morse, Michael A; Lyerly, H Kim

    2015-05-01

    Most dendritic cell (DC)-based vaccines have loaded the DC with defined antigens, but loading with autologos tumor-derived antigens would generate DCs that activate personalized tumor-specific T-cell responses. We hypothesized that DC matured with an optimized combination of reagents and loaded with tumor-derived antigens using a clinically feasible electroporation strategy would induce potent antitumor immunity. We first studied the effects on DC maturation and antigen presentation of the addition of picibanil (OK432) to a combination of zoledronic acid, tumor necrosis factor-α, and prostaglandin E2. Using DC matured with the optimized combination, we tested 2 clinically feasible sources of autologous antigen for electroloading, total tumor mRNA or total tumor lysate, to determine which stimulated more potent antigen-specific T cells in vitro and activated more potent antitumor immunity in vivo. The combination of tumor necrosis factor-α/prostaglandin E2/zoledronic acid/OK432 generated DC with high expression of maturation markers and antigen-specific T-cell stimulatory function in vitro. Mature DC electroloaded with tumor-derived mRNA [mRNA electroporated dendritic cell (EPDC)] induced greater expansion of antigen-specific T cells in vitro than DC electroloaded with tumor lysate (lysate EPDC). In a therapeutic model of MC38-carcinoembryonic antigen colon cancer-bearing mice, vaccination with mRNA EPDC induced the most efficient anti-carcinoembryonic antigen cellular immune response, which significantly suppressed tumor growth. In conclusion, mature DC electroloaded with tumor-derived mRNA are a potent cancer vaccine, especially useful when specific tumor antigens for vaccination have not been identified, allowing autologous tumor, and if unavailable, allogeneic cell lines to be used as an unbiased source of antigen. Our data support clinical testing of this strategy.

  7. Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

    PubMed

    Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

    2009-12-01

    p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and

  8. A Recombinant Antibody with the Antigen-Specific, Major Histocompatibility Complex-Restricted Specificity of T Cells

    NASA Astrophysics Data System (ADS)

    Andersen, Peter S.; Stryhn, Anette; Hansen, Bjarke E.; Fugger, Lars; Engberg, Jan; Buus, Soren

    1996-03-01

    Specific recognition of peptide/major histocompatibility complex (MHC) molecule complexes by the T-cell receptor is a key reaction in the specific immune response. Antibodies against peptide/MHC complexes would therefore be valuable tools in studying MHC function and T-cell recognition and might lead to novel approaches in immunotherapy. However, it has proven difficult to generate antibodies with the specificity of T cells by conventional hybridoma techniques. Here we report that the phage display technology is a feasible alternative to generate antibodies recognizing specific, predetermined peptide/MHC complexes.

  9. T cell subtypes and reciprocal inflammatory mediator expression differentiate P. falciparum memory recall responses in asymptomatic and symptomatic malaria patients in southeastern Haiti

    PubMed Central

    Campo, Joseph J.; Cicéron, Micheline; Raccurt, Christian P.; Beau De Rochars, Valery E. M.

    2017-01-01

    Asymptomatic Plasmodium falciparum infection is responsible for maintaining malarial disease within human populations in low transmission countries such as Haiti. Investigating differential host immune responses to the parasite as a potential underlying mechanism could help provide insight into this highly complex phenomenon and possibly identify asymptomatic individuals. We performed a cross-sectional analysis of individuals who were diagnosed with malaria in Sud-Est, Haiti by comparing the cellular and humoral responses of both symptomatic and asymptomatic subjects. Plasma samples were analyzed with a P. falciparum protein microarray, which demonstrated serologic reactivity to 3,877 P. falciparum proteins of known serologic reactivity; however, no antigen-antibody reactions delineating asymptomatics from symptomatics were identified. In contrast, differences in cellular responses were observed. Flow cytometric analysis of patient peripheral blood mononuclear cells co-cultured with P. falciparum infected erythrocytes demonstrated a statistically significant increase in the proportion of T regulatory cells (CD4+ CD25+ CD127-), and increases in unique populations of both NKT-like cells (CD3+ CD8+ CD56+) and CD8mid T cells in asymptomatics compared to symptomatics. Also, CD38+/HLA-DR+ expression on γδ T cells, CD8mid (CD56-) T cells, and CD8mid CD56+ NKT-like cells decreased upon exposure to infected erythrocytes in both groups. Cytometric bead analysis of the co-culture supernatants demonstrated an upregulation of monocyte-activating chemokines/cytokines in asymptomatics, while immunomodulatory soluble factors were elevated in symptomatics. Principal component analysis of these expression values revealed a distinct clustering of individual responses within their respective phenotypic groups. This is the first comprehensive investigation of immune responses to P. falciparum in Haiti, and describes unique cell-mediated immune repertoires that delineate individuals

  10. T cell subtypes and reciprocal inflammatory mediator expression differentiate P. falciparum memory recall responses in asymptomatic and symptomatic malaria patients in southeastern Haiti.

    PubMed

    Lehmann, Jason S; Campo, Joseph J; Cicéron, Micheline; Raccurt, Christian P; Boncy, Jacques; Beau De Rochars, Valery E M; Cannella, Anthony P

    2017-01-01

    Asymptomatic Plasmodium falciparum infection is responsible for maintaining malarial disease within human populations in low transmission countries such as Haiti. Investigating differential host immune responses to the parasite as a potential underlying mechanism could help provide insight into this highly complex phenomenon and possibly identify asymptomatic individuals. We performed a cross-sectional analysis of individuals who were diagnosed with malaria in Sud-Est, Haiti by comparing the cellular and humoral responses of both symptomatic and asymptomatic subjects. Plasma samples were analyzed with a P. falciparum protein microarray, which demonstrated serologic reactivity to 3,877 P. falciparum proteins of known serologic reactivity; however, no antigen-antibody reactions delineating asymptomatics from symptomatics were identified. In contrast, differences in cellular responses were observed. Flow cytometric analysis of patient peripheral blood mononuclear cells co-cultured with P. falciparum infected erythrocytes demonstrated a statistically significant increase in the proportion of T regulatory cells (CD4+ CD25+ CD127-), and increases in unique populations of both NKT-like cells (CD3+ CD8+ CD56+) and CD8mid T cells in asymptomatics compared to symptomatics. Also, CD38+/HLA-DR+ expression on γδ T cells, CD8mid (CD56-) T cells, and CD8mid CD56+ NKT-like cells decreased upon exposure to infected erythrocytes in both groups. Cytometric bead analysis of the co-culture supernatants demonstrated an upregulation of monocyte-activating chemokines/cytokines in asymptomatics, while immunomodulatory soluble factors were elevated in symptomatics. Principal component analysis of these expression values revealed a distinct clustering of individual responses within their respective phenotypic groups. This is the first comprehensive investigation of immune responses to P. falciparum in Haiti, and describes unique cell-mediated immune repertoires that delineate individuals

  11. Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

    PubMed Central

    2014-01-01

    Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

  12. Hsp70- and p53-reponses after heat treatment and/or X-irradiation mediate the susceptibility of hematopoietic cells to undergo apoptosis.

    PubMed

    Nijhuis, E H A; Poot, A A; Feijen, J; Vermes, I

    2008-02-01

    The effect of heat treatment in combination with X-irradiation was examined with regard to expression of p53, a tumor suppressor gene product, and Hsp70, a heat-shock protein, in association with the occurrence of programmed cell death (apoptosis). Three hematopoietic cell lines (HSB2, HL60 and Kasumi-1), which differ in p53 status, were exposed to 42.5 degrees C during one hour and/or X-radiation (total dose 8 Gy). After exposure, both mRNA and protein expression levels of Hsp70 and p53 were investigated by real-time PCR (polymerase chain reaction) and Western blotting. Apoptosis was simultaneously analyzed by observation of cell morphology as well as flowcytometric determination of Annexin V binding to phosphatidylserine and propidium iodide exclusion. Both HL60 and HSB2 cell lines with a low p53 status and a quick response to heat treatment with Hsp70 over-expression are less susceptible to heat-induced apoptosis compared to Kasumi-1 cells with wild-type p53 protein and no Hsp70 response. The combination of first applying X-irradiation followed by heat treatment resulted in the most effective induction of apoptosis due to impairment of the Hsp70 response in all three cell lines. These results indicate that the Hsp70 response and p53 status mediate the susceptibility of hematopoietic cells to undergo heat-induced apoptosis. Therefore, these parameters can be used as markers to predict the effectiveness of hyperthermia in cancer treatment.

  13. Circulating rotavirus-specific T cells have a poor functional profile.

    PubMed

    Parra, Miguel; Herrera, Daniel; Jácome, María Fernanda; Mesa, Martha C; Rodríguez, Luz-Stella; Guzmán, Carolina; Angel, Juana; Franco, Manuel A

    2014-11-01

    Frequencies of circulating T cells producing IFN-γ, TNF-α, and IL-2, and percentages of T cells proliferating after stimulation with rotavirus (RV), tetanus toxoid, and influenza were evaluated in PBMC derived from healthy adults and children. In addition, the potential anergic state of RV-specific T cells was analyzed by stimulation of PBMC with RV antigen in the presence of three anergy inhibitors (rIL-2, rIL-12, or DGKα-i). The quality and magnitude of RV-T cell responses were significantly lower than those of tetanus toxoid and influenza antigens. RV-CD4 T cell response was enriched in monofunctional IFN-γ(+) cells, while influenza-CD4 and tetanus toxoid-CD4 T cell responses were enriched in multifunctional T cells. Moreover, rIL-2--unlike rIL-12 or DGKα-i--increased the frequencies of RV-CD4 TNF-α(+), CD4 IFN-γ(+), and CD8 IFN-γ(+) cells. Thus, circulating RV-T cells seem to have a relatively poor functional profile that may be partially reversed in vitro by the addition of rIL-2. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin

    2008-01-25

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt}more » cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.« less

  15. Generation of TCR-Expressing Innate Lymphoid-like Helper Cells that Induce Cytotoxic T Cell-Mediated Anti-leukemic Cell Response.

    PubMed

    Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin

    2018-06-05

    CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  16. p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

    PubMed Central

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

  17. p53 is a key regulator for osthole-triggered cancer pathogenesis.

    PubMed

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

  18. Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2

    PubMed Central

    Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D

    2002-01-01

    A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296

  19. Memory T-Cell-Mediated Immune Responses Specific to an Alternative Core Protein in Hepatitis C Virus Infection

    PubMed Central

    Bain, Christine; Parroche, Peggy; Lavergne, Jean Pierre; Duverger, Blandine; Vieux, Claude; Dubois, Valérie; Komurian-Pradel, Florence; Trépo, Christian; Gebuhrer, Lucette; Paranhos-Baccala, Glaucia; Penin, François; Inchauspé, Geneviève

    2004-01-01

    In vitro studies have described the synthesis of an alternative reading frame form of the hepatitis C virus (HCV) core protein that was named F protein or ARFP (alternative reading frame protein) and includes a domain coded by the +1 open reading frame of the RNA core coding region. The expression of this protein in HCV-infected patients remains controversial. We have analyzed peripheral blood from 47 chronically or previously HCV-infected patients for the presence of T lymphocytes and antibodies specific to the ARFP. Anti-ARFP antibodies were detected in 41.6% of the patients infected with various HCV genotypes. Using a specific ARFP 99-amino-acid polypeptide as well as four ARFP predicted class I-restricted 9-mer peptides, we show that 20% of the patients display specific lymphocytes capable of producing gamma interferon, interleukin-10, or both cytokines. Patients harboring three different viral genotypes (1a, 1b, and 3) carried T lymphocytes reactive to genotype 1b-derived peptides. In longitudinal analysis of patients receiving therapy, both core and ARFP-specific T-cell- and B-cell-mediated responses were documented. The magnitude and kinetics of the HCV antigen-specific responses differed and were not linked with viremia or therapy outcome. These observations provide strong and new arguments in favor of the synthesis, during natural HCV infection, of an ARFP derived from the core sequence. Moreover, the present data provide the first demonstration of the presence of T-cell-mediated immune responses directed to this novel HCV antigen. PMID:15367612

  20. The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

    PubMed

    Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

    2014-03-18

    Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

    PubMed

    Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

    2018-04-01

    Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

  2. p63 and p73 coordinate p53 function to determine the balance between survival, cell death, and senescence in adult neural precursor cells

    PubMed Central

    Fatt, M P; Cancino, G I; Miller, F D; Kaplan, D R

    2014-01-01

    The p53 family members p73 and p63 have been implicated in various aspects of stem cell regulation. Here, we have asked whether they work together to regulate stem cell biology, focusing upon neural precursor cells (NPCs) in the adult murine brain. By studying mice that are haploinsufficient for p63 and/or p73, we show that these two proteins cooperate to ensure appropriate NPC self-renewal and long-term maintenance in the hippocampus and forebrain, and that when both are haploinsufficient, the NPC deficits are significantly greater than haploinsufficiency for either alone. We show that, in the case of p63+/− mice, this decrease in adult NPCs is caused by enhanced apoptosis. However, when p73 is coincidently haploinsufficient, this rescues the enhanced apoptosis of p63+/− NPCs under both basal conditions and following genotoxic stress, instead causing increased cellular senescence. This increase in cellular senescence is likely due, at least in part, to increased levels of basal DNA damage and p53 activation, as genetic ablation of p53 completely rescues the senescence phenotype observed in p63+/−; p73+/− mice. Thus, the presence of p73 determines whether p63+/− NPCs exhibit increased p53-dependent apoptosis or senescence. Together, these studies demonstrate that p63 and p73 cooperate to maintain adult NPC pools through regulation of p53 function; p63 antagonizes p53 to promote cellular survival, whereas p73 regulates self-renewal and p53-mediated apoptosis versus senescence. PMID:24809925

  3. Characterization of the Fine Specificity of Bovine CD8 T-Cell Responses to Defined Antigens from the Protozoan Parasite Theileria parva▿

    PubMed Central

    Graham, Simon P.; Pellé, Roger; Yamage, Mat; Mwangi, Duncan M.; Honda, Yoshikazu; Mwakubambanya, Ramadhan S.; de Villiers, Etienne P.; Abuya, Evelyne; Awino, Elias; Gachanja, James; Mbwika, Ferdinand; Muthiani, Anthony M.; Muriuki, Cecelia; Nyanjui, John K.; Onono, Fredrick O.; Osaso, Julius; Riitho, Victor; Saya, Rosemary M.; Ellis, Shirley A.; McKeever, Declan J.; MacHugh, Niall D.; Gilbert, Sarah C.; Audonnet, Jean-Christophe; Morrison, W. Ivan; van der Bruggen, Pierre; Taracha, Evans L. N.

    2008-01-01

    Immunity against the bovine intracellular protozoan parasite Theileria parva has been shown to be mediated by CD8 T cells. Six antigens targeted by CD8 T cells from T. parva-immune cattle of different major histocompatibility complex (MHC) genotypes have been identified, raising the prospect of developing a subunit vaccine. To facilitate further dissection of the specificity of protective CD8 T-cell responses and to assist in the assessment of responses to vaccination, we set out to identify the epitopes recognized in these T. parva antigens and their MHC restriction elements. Nine epitopes in six T. parva antigens, together with their respective MHC restriction elements, were successfully identified. Five of the cytotoxic-T-lymphocyte epitopes were found to be restricted by products of previously described alleles, and four were restricted by four novel restriction elements. Analyses of CD8 T-cell responses to five of the epitopes in groups of cattle carrying the defined restriction elements and immunized with live parasites demonstrated that, with one exception, the epitopes were consistently recognized by animals of the respective genotypes. The analysis of responses was extended to animals immunized with multiple antigens delivered in separate vaccine constructs. Specific CD8 T-cell responses were detected in 19 of 24 immunized cattle. All responder cattle mounted responses specific for antigens for which they carried an identified restriction element. By contrast, only 8 of 19 responder cattle displayed a response to antigens for which they did not carry an identified restriction element. These data demonstrate that the identified antigens are inherently dominant in animals with the corresponding MHC genotypes. PMID:18070892

  4. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  5. Anti-bacterial antibody and T cell responses in bronchiectasis are differentially associated with lung colonization and disease.

    PubMed

    Jaat, Fathia G; Hasan, Sajidah F; Perry, Audrey; Cookson, Sharon; Murali, Santosh; Perry, John D; Lanyon, Clare V; De Soyza, Anthony; Todryk, Stephen M

    2018-05-30

    As a way to determine markers of infection or disease informing disease management, and to reveal disease-associated immune mechanisms, this study sought to measure antibody and T cell responses against key lung pathogens and to relate these to patients' microbial colonization status, exacerbation history and lung function, in Bronchiectasis (BR) and Chronic Obstructive Pulmonary Disease (COPD). One hundred nineteen patients with stable BR, 58 with COPD and 28 healthy volunteers were recruited and spirometry was performed. Bacterial lysates were used to measure specific antibody responses by ELISA and T cells by ELIspot. Cytokine secretion by lysate-stimulated T cells was measured by multiplex cytokine assay whilst activation phenotype was measured by flow cytometry. Typical colonization profiles were observed in BR and COPD, dominated by P.aeruginosa, H.influenzae, S.pneumoniae and M.catarrhalis. Colonization frequency was greater in BR, showing association with increased antibody responses against P.aeruginosa compared to COPD and HV, and with sensitivity of 73% and specificity of 95%. Interferon-gamma T cell responses against P.aeruginosa and S.pneumoniae were reduced in BR and COPD, whilst reactive T cells in BR had similar markers of homing and senescence compared to healthy volunteers. Exacerbation frequency in BR was associated with increased antibodies against P. aeruginosa, M.catarrhalis and S.maltophilia. T cell responses against H.influenzae showed positive correlation with FEV 1 % (r = 0.201, p = 0.033) and negative correlation with Bronchiectasis Severity Index (r = - 0.287, p = 0.0035). Our findings suggest a difference in antibody and T cell immunity in BR, with antibody being a marker of exposure and disease in BR for P.aeruginosa, M.catarrhalis and H.influenzae, and T cells a marker of reduced disease for H.influenzae.

  6. Strong and frequent T-cell responses to the minor allergen Phl p 12 in Spanish patients IgE-sensitized to Profilins.

    PubMed

    Lund, G; Brand, S; Ramos, T; Jimeno, L; Boissy, P; Vega, F; Arina, M; Christensen, L H; Hoof, I; Meno, K H; Barber, D; Blanco, C; Würtzen, P A; Andersen, P S

    2018-05-01

    Profilins are dominant pan-allergens known to cause cross-sensitization, leading to clinical symptoms such as pollen-food syndrome. This study aimed to determine the T-cell response to Phl p 12 in profilin-sensitized patients, by measuring the prevalence, strength and cross-reactivity to clinically relevant profilins. The release of Phl p allergens from pollen was determined by mass spectrometry and immunochemistry. T-cell responses, epitope mapping and cross-reactivity to profilins (Phl p 12, Ole e 2, Bet v 2 and Mal d 4) were measured in vitro using PBMCs from 26 Spanish grass-allergic donors IgE-sensitized to profilin. Cross-reactivity was addressed in vivo using 2 different mouse strains (BALB/c and C3H). Phl p 12 and Phl p 1 are released from pollen simultaneously and in similar amounts. Both T-cell response frequency (17/26 donors) and strength were comparable between Phl p 12 and Phl p 1. T-cell cross-reactivity to other profilins correlated with overall sequence homology, and 2 immunodominant epitope regions of Phl p 12 were identified. Data from mice immunized with Phl p 12 showed that cross-reactivity to Bet v 2 was mediated by conserved epitopes and further influenced by additional genetic factors, likely to be MHC II. The strength, prevalence and cross-reactivity of T-cell responses towards Phl p 12 are comparable to the major allergen Phl p 1, which supports the hypothesis that T cells to Phl p 12 can play an important role in development of allergic symptoms, such as those associated with pollen-food syndrome. © 2017 EAACI and John Wiley and Sons A/S. Published by John Wiley and Sons Ltd.

  7. Peripheral self-reactivity regulates antigen-specific CD8 T-cell responses and cell division under physiological conditions.

    PubMed

    Swee, Lee Kim; Tan, Zhen Wei; Sanecka, Anna; Yoshida, Nagisa; Patel, Harshil; Grotenbreg, Gijsbert; Frickel, Eva-Maria; Ploegh, Hidde L

    2016-11-01

    T-cell identity is established by the expression of a clonotypic T-cell receptor (TCR), generated by somatic rearrangement of TCRα and β genes. The properties of the TCR determine both the degree of self-reactivity and the repertoire of antigens that can be recognized. For CD8 T cells, the relationship between TCR identity-hence reactivity to self-and effector function(s) remains to be fully understood and has rarely been explored outside of the H-2 b haplotype. We measured the affinity of three structurally distinct CD8 T-cell-derived TCRs that recognize the identical H-2 L d -restricted epitope, derived from the Rop7 protein of Toxoplasma gondii We used CD8 T cells obtained from mice generated by somatic cell nuclear transfer as the closest approximation of primary T cells with physiological TCR rearrangements and TCR expression levels. First, we demonstrate the common occurrence of secondary rearrangements in endogenously rearranged loci. Furthermore, we characterized and compared the response of Rop7-specific CD8 T-cell clones upon Toxoplasma gondii infection as well as effector function and TCR signalling upon antigenic stimulation in vitro Antigen-independent TCR cross-linking in vitro uncovered profound intrinsic differences in the effector functions between T-cell clones. Finally, by assessing the degree of self-reactivity and comparing the transcriptomes of naive Rop7 CD8 T cells, we show that lower self-reactivity correlates with lower effector capacity, whereas higher self-reactivity is associated with enhanced effector function as well as cell cycle entry under physiological conditions. Altogether, our data show that potential effector functions and basal proliferation of CD8 T cells are set by self-reactivity thresholds. © 2016 The Authors.

  8. Differential programming of p53-deficient embryonic cells during rotenone block

    EPA Science Inventory

    Mitochondrial dysfunction has been implicated in chemical toxicities. The present study used an in vitro model to investigate the differential expression of metabolic pathways during cellular stress in p53- efficient embryonic fibroblasts compared to p53-deficient cells. These c...

  9. P53 alters the cytotoxicity and genotoxicity for oxidized graphene in human B-lymphoblastoid cells

    NASA Astrophysics Data System (ADS)

    Petibone, Dayton Matthew

    Widespread use of oxidized graphene nanomaterials in industry, medicine, and consumer products raises concern about potential adverse impacts on human health. The p53 tumor suppressor protein is crucial to maintaining cellular and genetic stability to prevent carcinogenesis. Here, we show that oxygen functionalized graphene (f-G) absorption and p53 functional status correlate with cytotoxicity and genotoxicity in human B-lymphoblastoid cells. Trends in f-G absorption by were dose-dependent. Cells with functional p53 exposed to f-G arrested in G0/G1 phase of the cell cycle, suppressed f-G induced reactive oxygen species (ROS), and had elevated apoptosis. While compared to p53 competent cells, the p53 deficient cells exposed to f-G accumulated in S-phase of the cell cycle, had elevated ROS levels, and evaded apoptosis. The f-G genotoxicity was evident as increased loss-of-heterozygosity mutants independent of p53 status, and structural chromosome damage in p53 deficient cells. These findings have broad implications for the safety and efficacy of oxidized graphene nanomaterials in industrial, consumer products and biomedical applications.

  10. Dihydrolipoamide dehydrogenase-Lpd (Rv0462)-specific T cell recall responses are higher in healthy household contacts of TB: a novel immunodominant antigen from M. tuberculosis.

    PubMed

    Devasundaram, Santhi; Raja, Alamelu

    2017-07-01

    The partial effectiveness against pulmonary tuberculosis (PTB), displayed by the existing tuberculosis (TB) vaccine, bacillus Calmette-Guérin (BCG), highlights the need for novel vaccines to replace or improve BCG. In TB immunology, antigen-specific cellular immune response is frequently considered indispensable. Latency-associated antigens are intriguing as targets for TB vaccine development. The mycobacterial protein, dihydrolipoamide dehydrogenase (Lpd; Rv0462), the third enzyme of the pyruvate dehydrogenase (PDH) complex, facilitates Mycobacterium tuberculosis to resist host reactive nitrogen intermediates. Multicolor flow cytometry analysis of whole-blood cultures showed higher Lpd-specific Th1 recall response (IFN-γ, TNF-α, and IL-2; P = 0.0006) and memory CD4 + and CD8 + T cells (CCR7 + CD45RA - and CCR7 - CD45RA - ) in healthy household contacts (HHC) of TB ( P < 0.0001), which is comparable with or higher than the standard antigens, ESAT-6 and CFP-10. The frequency of Lpd-specific multifunctional T cells was higher in HHC compared with PTB patients. However, there is no significant statistical correlation. Regulatory T cell (T reg ) analysis of HHCs and active TB patients demonstrated very low Lpd-specific CD4 + T regs relative to ESAT-6 and CFP-10. Our study demonstrates that the Lpd antigen induces a strong cellular immune response in healthy mycobacteria-infected individuals. In consideration of this population having demonstrated immunologic protection against active TB disease development, our data are encouraging about the possible use of Lpd as a target for further TB subunit vaccine development. © Society for Leukocyte Biology.

  11. Protective CD8 Memory T Cell Responses to Mouse Melanoma Are Generated in the Absence of CD4 T Cell Help

    PubMed Central

    Steinberg, Shannon M.; Zhang, Peisheng; Turk, Mary Jo

    2011-01-01

    Background We have previously demonstrated that temporary depletion of CD4 T cells in mice with progressive B16 melanoma, followed by surgical tumor excision, induces protective memory CD8 T cell responses to melanoma/melanocyte antigens. We also showed that persistence of these CD8 T cells is supported, in an antigen-dependent fashion, by concurrent autoimmune melanocyte destruction. Herein we explore the requirement of CD4 T cell help in priming and maintaining this protective CD8 T cell response to melanoma. Methodology and Principal Findings To induce melanoma/melanocyte antigen-specific CD8 T cells, B16 tumor bearing mice were depleted of regulatory T cells (Treg) by either temporary, or long-term continuous treatment with anti-CD4 (mAb clone GK1.5). Total depletion of CD4 T cells led to significant priming of IFN-γ-producing CD8 T cell responses to TRP-2 and gp100. Surprisingly, treatment with anti-CD25 (mAb clone PC61), to specifically deplete Treg cells while leaving help intact, was ineffective at priming CD8 T cells. Thirty to sixty days after primary tumors were surgically excised, mice completely lacking CD4 T cell help developed autoimmune vitiligo, and maintained antigen-specific memory CD8 T cell responses that were highly effective at producing cytokines (IFN-γ, TNF-α, and IL-2). Mice lacking total CD4 T cell help also mounted protection against re-challenge with B16 melanoma sixty days after primary tumor excision. Conclusions and Significance This work establishes that CD4 T cell help is dispensable for the generation of protective memory T cell responses to melanoma. Our findings support further use of CD4 T cell depletion therapy for inducing long-lived immunity to cancer. PMID:22046294

  12. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    PubMed

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  13. p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

    PubMed

    Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

    2018-05-28

    p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  14. GM-CSF-Induced Regulatory T cells Selectively Inhibit Anti-Acetylcholine Receptor-Specific Immune Responses in Experimental Myasthenia Gravis

    PubMed Central

    Sheng, Jian Rong; Muthusamy, Thiruppathi; Prabahakar, Bellur S.; Meriggioli, Matthew N.

    2011-01-01

    We and others have demonstrated the ability of granulocyte-macrophage colony-stimulating factor (GM-CSF) to suppress autoimmunity by increasing the number of CD4+CD25+ regulatory T cells (Tregs). In the current study, we have explored the critical role of induced antigen specific Tregs in the therapeutic effects of GM-CSF in murine experimental autoimmune myasthenia gravis (EAMG). Specifically, we show that Tregs from GM-CSF treated EAMG mice (GM-CSF/AChR-induced-Tregs) adoptively transferred into animals with EAMG suppressed clinical disease more potently than equal numbers of Tregs from either GM-CSF untreated EAMG mice or healthy mice treated with GM-CSF. In addition, GM-CSF/AChR-induced-Tregs selectively suppressed antigen specific T cell proliferation induced by AChR relative to that induced by an irrelevant self antigen, (thyroglobulin) and failed to significantly alter T cell proliferation in response to an exogenous antigen (ovalbumin). These results are consistent with the hypothesized mechanism of action of GM-CSF involving the mobilization of tolerogenic dendritic cell precursors which, upon antigen (AChR) capture, suppress the anti-AChR immune response through the induction/expansion of AChR-specific Tregs. PMID:22099723

  15. CRISPR-Cas9-based target validation for p53-reactivating model compounds

    PubMed Central

    Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

    2015-01-01

    Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

  16. T cell-specific deletion of the inositol phosphatase SHIP reveals its role in regulating Th1/Th2 and cytotoxic responses

    PubMed Central

    Tarasenko, Tatyana; Kole, Hemanta K.; Chi, Anthony W.; Mentink-Kane, Margaret M.; Wynn, Thomas A.; Bolland, Silvia

    2007-01-01

    The 5′-phosphoinositol phosphatase SHIP negatively regulates signaling pathways triggered by antigen, cytokine and Fc receptors in both lymphocytes and myeloid cells. Mice with germ-line (null) deletion of SHIP develop a myeloproliferative-like syndrome that causes early lethality. Lymphocyte anomalies have been observed in SHIP-null mice, but it is unclear whether they are due to an intrinsic requirement of SHIP in these cells or a consequence of the severe myeloid pathology. To precisely address the function of SHIP in T cells, we have generated mice with T cell-specific deletion of SHIP. In the absence of SHIP, we found no differences in thymic selection or in the activation state and numbers of regulatory T cells in the periphery. In contrast, SHIP-deficient T cells do not skew efficiently to Th2 in vitro. Mice with T cell-specific deletion of SHIP show poor antibody responses on Alum/NP-CGG immunization and diminished Th2 cytokine production when challenged with Schistosoma mansoni eggs. The failure to skew to Th2 responses may be the consequence of increased basal levels of the Th1-associated transcriptional factor T-bet, resulting from enhanced sensitivity to cytokine-mediated T-bet induction. SHIP-deficient CD8+ cells show enhanced cytotoxic responses, consistent with elevated T-bet levels in these cells. Overall our experiments indicate that in T cells SHIP negatively regulates cytokine-mediated activation in a way that allows effective Th2 responses and limits T cell cytotoxicity. PMID:17585010

  17. MicroRNA-125b is a novel negative regulator of p53.

    PubMed

    Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing

    2009-04-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.

  18. MicroRNA-125b is a novel negative regulator of p53

    PubMed Central

    Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing

    2009-01-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287

  19. Frequency and reactivity of antigen-specific T cells were concurrently measured through the combination of artificial antigen-presenting cell, MACS and ELISPOT.

    PubMed

    Shen, Chuanlai; Xu, Tao; Wu, You; Li, Xiaoe; Xia, Lingzhi; Wang, Wei; Shahzad, Khawar Ali; Zhang, Lei; Wan, Xin; Qiu, Jie

    2017-11-27

    Conventional peptide-major histocompatibility complex (pMHC) multimer staining, intracellular cytokine staining, and enzyme-linked immunospot (ELISPOT) assay cannot concurrently determine the frequency and reactivity of antigen-specific T cells (AST) in a single assay. In this report, pMHC multimer, magnetic-activated cell sorting (MACS), and ELISPOT techniques have been integrated into a micro well by coupling pMHC multimers onto cell-sized magnetic beads to characterize AST cell populations in a 96-well microplate which pre-coated with cytokine-capture antibodies. This method, termed AAPC-microplate, allows the enumeration and local cytokine production of AST cells in a single assay without using flow cytometry or fluorescence intensity scanning, thus will be widely applicable. Here, ovalbumin 257-264 -specific CD8 + T cells from OT-1 T cell receptor (TCR) transgenic mice were measured. The methodological accuracy, specificity, reproducibility, and sensitivity in enumerating AST cells compared well with conventional pMHC multimer staining. Furthermore, the AAPC-microplate was applied to detect the frequency and reactivity of Hepatitis B virus (HBV) core antigen 18-27 - and surface antigen 183-191 -specific CD8 + T cells for the patients, and was compared with conventional method. This method without the need of high-end instruments may facilitate the routine analysis of patient-specific cellular immune response pattern to a given antigen in translational studies.

  20. p53 and c-myc activation by Pasteurella haemolytica leukotoxin is correlated with bovine mononuclear cells apoptosis.

    PubMed

    Marcatili, A; D'Isanto, M; Vitiello, M; Galdiero, R; Galdiero, M

    2002-04-01

    To analyse the role of Pasteurella haemolytica Leukotoxin (LKT) in the mechanism of apoptotic cell death of bovine lymphocytes, we evaluated DNA fragmentation and p53 and c-myc expression. P. haemolytica strain ATCC 14003 was cultivated for LKT production. DNA fragmentation was analysed by electrophoresis on Agarose gel. DNA strand breaks in individual apoptotic cells were also detected by an in situ Terminal deoxy nucleotidyl Transferase (TdT). The Polymerase Chain Reaction (PCR) procedure was used for verified p53 and c-myc activation by P. haemolytica LKT. LKT was able to induce DNA fragmentation in a dose and time-dependent fashion. The greatest apoptotic effect was obtained using LKT at a concentration of 0.25 U. The results show that p53 and c-myc activation by LKT is correlated with apoptosis of bovine lymphocytes and monocytes. Our data suggest that LKT may have an important role in the bacterial virulence of Pasteurella haemolytica.

  1. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less

  2. Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

    PubMed Central

    Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

    2016-01-01

    Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

  3. FoxP3+ CD25+ CD8+ T-Cell Induction during Primary Simian Immunodeficiency Virus Infection in Cynomolgus Macaques Correlates with Low CD4+ T-Cell Activation and High Viral Load▿

    PubMed Central

    Karlsson, Ingrid; Malleret, Benoît; Brochard, Patricia; Delache, Benoît; Calvo, Julien; Le Grand, Roger; Vaslin, Bruno

    2007-01-01

    The early immune response fails to prevent the establishment of chronic human immunodeficiency virus (HIV) infection but may influence viremia during primary infection, thereby possibly affecting long-term disease progression. CD25+ FoxP3+ regulatory T cells may contribute to HIV/simian immunodeficiency virus (SIV) pathogenesis by suppressing efficient antiviral responses during primary infection, favoring high levels of viral replication and the establishment of chronic infection. In contrast, they may decrease immune activation during chronic infection. CD4+ regulatory T cells have been studied in the most detail, but CD8+ CD25+ FoxP3+ T cells also have regulatory properties. We monitored the dynamics of CD25+ FoxP3+ T cells during primary and chronic SIVmac251 infection in cynomolgus macaques. The number of peripheral CD4+ CD25+ FoxP3+ T cells paralleled that of memory CD4+ T cells, with a rapid decline during primary infection followed by a rebound to levels just below baseline and gradual depletion during the course of infection. No change in the proportion of CD25+ FoxP3+ T cells was observed in peripheral lymph nodes. A small number of CD4+ CD25+ FoxP3+ T cells at set point was associated with a high plasma viral load. In contrast, peripheral CD8+ CD25+ FoxP3+ T cells were induced a few days after peak plasma viral load during primary infection. The number of these cells was positively correlated with viral load and negatively correlated with CD4+ T-cell activation, SIV antigen-specific proliferative responses during primary infection, and plasma viral load at set point, with large numbers of CD8+ CD25+ FoxP3+ T cells being indicative of a poor prognosis. PMID:17898053

  4. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  5. CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

    PubMed

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-07-25

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

  6. Semi-allogeneic dendritic cells can induce antigen-specific T-cell activation, which is not enhanced by concurrent alloreactivity.

    PubMed

    Wells, James W; Cowled, Chris J; Darling, David; Guinn, Barbara-Ann; Farzaneh, Farzin; Noble, Alistair; Galea-Lauri, Joanna

    2007-12-01

    Alloreactive T-cell responses are known to result in the production of large amounts of proinflammatory cytokines capable of activating and maturing dendritic cells (DC). However, it is unclear whether these allogeneic responses could also act as an adjuvant for concurrent antigen-specific responses. To examine effects of simultaneous alloreactive and antigen-specific T-cell responses induced by semi-allogeneic DC. Semi-allogeneic DC were generated from the F(1) progeny of inbred strains of mice (C57BL/6 and C3H, or C57BL/6 and DBA). We directly primed antigen-specific CD8(+) and CD4(+) T-cells from OT-I and OT-II mice, respectively, in the absence of allogeneic responses, in vitro, and in the presence or absence of alloreactivity in vivo. In vitro, semi-allogeneic DC cross-presented ovalbumin (OVA) to naïve CD8(+) OT-I transgenic T-cells, primed naïve CD4(+) OT-II transgenic T-cells and could stimulate strong alloreactive T-cell proliferation in a primary mixed lymphocyte reaction (MLR). In vivo, semi-allogeneic DC migrated efficiently to regional lymph nodes but did not survive there as long as autologous DC. In addition, they were not able to induce cytotoxic T-lymphocyte (CTL) activity to a target peptide, and only weakly stimulated adoptively transferred OT-II cells. The CD4(+) response was unchanged in allo-tolerized mice, indicating that alloreactive T-cell responses could not provide help for concurrently activated antigen-specific responses. In an EL4 tumour-treatment model, vaccination with semi-allogeneic DC/EL4 fusion hybrids, but not allogeneic DC/EL4 hybrids, significantly increased mouse survival. Expression of self-Major histocompatibility complex (MHC) by semi-allogeneic DC can cause the induction of antigen-specific immunity, however, concurrently activated allogeneic bystander responses do not provide helper or adjuvant effects.

  7. Cytomegalovirus-Specific CD8+ T-Cells With Different T-Cell Receptor Affinities Segregate T-Cell Phenotypes and Correlate With Chronic Graft-Versus-Host Disease in Patients Post-Hematopoietic Stem Cell Transplantation

    PubMed Central

    Poiret, Thomas; Axelsson-Robertson, Rebecca; Remberger, Mats; Luo, Xiao-Hua; Rao, Martin; Nagchowdhury, Anurupa; Von Landenberg, Anna; Ernberg, Ingemar; Ringden, Olle; Maeurer, Markus

    2018-01-01

    Virus-specific T-cell responses are crucial to control cytomegalovirus (CMV) infections/reactivation in immunocompromised individuals. Adoptive cellular therapy with CMV-specific T-cells has become a viable treatment option. High-affinity anti-viral cellular immune responses are associated with improved long-term immune protection against CMV infection. To date, the characterization of high-affinity T-cell responses against CMV has not been achieved in blood from patients after allogeneic hematopoietic stem cell transplantation (HSCT). Therefore, the purpose of this study was to describe and analyze the phenotype and clinical impact of different CMV-specific CD8+ cytotoxic T-lymphocytes (CMV-CTL) classes based on their T-cell receptor (TCR) affinity. T-cells isolated from 23 patients during the first year following HSCT were tested for the expression of memory markers, programmed cell death 1 (PD-1), as well as TCR affinity, using three different HLA-A*02:01 CMVNLVPMVATV-Pp65 tetramers (wild-type, a245v and q226a mutants). High-affinity CMV-CTL defined by q226a tetramer binding, exhibited a higher frequency in CD8+ T-cells in the first month post-HSCT and exhibited an effector memory phenotype associated with strong PD-1 expression as compared to the medium- and low-affinity CMV-CTLs. High-affinity CMV-CTL was found at higher proportion in patients with chronic graft-versus-host disease (p < 0.001). This study provides a first insight into the detailed TCR affinities of CMV-CTL. This may be useful in order to improve current immunotherapy protocols using isolation of viral-specific T-cell populations based on their TCR affinity. PMID:29692783

  8. Plasmacytoid dendritic cell and functional HIV Gag p55-specific T cells before treatment interruption can inform set-point plasma HIV viral load after treatment interruption in chronically suppressed HIV-1(+) patients.

    PubMed

    Papasavvas, Emmanouil; Foulkes, Andrea; Yin, Xiangfan; Joseph, Jocelin; Ross, Brian; Azzoni, Livio; Kostman, Jay R; Mounzer, Karam; Shull, Jane; Montaner, Luis J

    2015-07-01

    The identification of immune correlates of HIV control is important for the design of immunotherapies that could support cure or antiretroviral therapy (ART) intensification-related strategies. ART interruptions may facilitate this task through exposure of an ART partially reconstituted immune system to endogenous virus. We investigated the relationship between set-point plasma HIV viral load (VL) during an ART interruption and innate/adaptive parameters before or after interruption. Dendritic cell (DC), natural killer (NK) cell and HIV Gag p55-specific T-cell functional responses were measured in paired cryopreserved peripheral blood mononuclear cells obtained at the beginning (on ART) and at set-point of an open-ended interruption from 31 ART-suppressed chronically HIV-1(+) patients. Spearman correlation and linear regression modeling were used. Frequencies of plasmacytoid DC (pDC), and HIV Gag p55-specific CD3(+)  CD4(-)  perforin(+)  IFN-γ(+) cells at the beginning of interruption associated negatively with set-point plasma VL. Inclusion of both variables with interaction into a model resulted in the best fit (adjusted R(2)  = 0·6874). Frequencies of pDC or HIV Gag p55-specific CD3(+)  CD4(-)  CSFE(lo)  CD107a(+) cells at set-point associated negatively with set-point plasma VL. The dual contribution of pDC and anti-HIV T-cell responses to viral control, supported by our models, suggests that these variables may serve as immune correlates of viral control and could be integrated in cure or ART-intensification strategies. © 2015 John Wiley & Sons Ltd.

  9. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

  10. The impact of pregnancy on the HIV-1-specific T cell function in infected pregnant women.

    PubMed

    Hygino, Joana; Vieira, Morgana M; Kasahara, Taissa M; Xavier, Luciana F; Blanco, Bernardo; Guillermo, Landi V C; Filho, Renato G S; Saramago, Carmen S M; Lima-Silva, Agostinho A; Oliveira, Ariane L; Guimarães, Vander; Andrade, Arnaldo F B; Bento, Cleonice A M

    2012-12-01

    Evidences indicate that pregnancy can alter the Ag-specific T-cell responses. This work aims to evaluate the impact of pregnancy on the in vitro HIV-1-specific immune response. As compared with non-pregnant patients, lower T-cell proliferation and higher IL-10 production were observed in T-cell cultures from pregnant patients following addition of either mitogens or HIV-1 antigens. In our system, the main T lymphocyte subset involved in producing IL-10 was CD4(+)FoxP3(-). Depletion of CD4(+) cells elevated TNF-α and IFN-γ production. Interestingly, the in vitro HIV-1 replication was lower in cell cultures from pregnant patients, and it was inversely related to IL-10 production. In these cultures, the neutralization of IL-10 by anti-IL-10 mAb elevated TNF-α release and HIV-1 replication. In conclusion, our results reveal that pregnancy-related events should favor the expansion of HIV-1-specific IL-10-secreting CD4(+) T-cells in HIV-1-infected women, which should, in the scenario of pregnancy, help to reduce the risk of vertical HIV-1 transmission. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

    PubMed

    Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

    2014-07-23

    The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Pontin is required for pre-TCR signaling at the β-selection checkpoint in T cell development.

    PubMed

    Boo, Kyungjin; Baek, Sung Hee; Lee, Ho

    2014-04-25

    Pontin is a chromatin remodeling factor that possesses both ATPase and DNA helicase activities. Based on high expression in lymphoid tissues, we examined whether Pontin has a T cell-specific function. We generated Pontin(f/f);Lck-Cre mice, in which Pontin can be conditionally deleted in T cells and then explored T cell-specific function of Pontin in vivo. Here, we show that specific abrogation of Pontin expression in T cells almost completely blocked development of αβ T cells at the β-selection checkpoint by inducing cell apoptosis indicating that Pontin is essential for early T cell development. Pontin-deficient thymocytes show a comparable expression level of T cell receptor (TCR)β chain, but have enhanced activation of p53 and Notch signaling compared to wild-type thymocytes. Intriguingly, the developmental block of αβ T cells can be partially rescued by loss of p53. Together, our data demonstrate a novel role of Pontin as a crucial regulator in pre-TCR signaling during T cell development. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    PubMed

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  14. The Isoforms of the p53 Protein

    PubMed Central

    Khoury, Marie P.; Bourdon, Jean-Christophe

    2010-01-01

    p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

  15. Preliminary report on the effect of brachytherapy on expression of p53, bc1-2 and apoptosis in squamous cell carcinoma of the oesophagus.

    PubMed

    Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon

    2003-02-01

    Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.

  16. Zoledronic acid induces dose-dependent increase of antigen-specific CD8 T-cell responses in combination with peptide/poly-IC vaccine.

    PubMed

    Park, Hye-Mi; Cho, Hyun-Il; Shin, Chang-Ae; Shon, Hyun-Jung; Kim, Tai-Gyu

    2016-03-04

    Zoledronic acid (ZA) is used for treating osteoporosis and for preventing skeletal fractures in cancer patients suffering from myeloma and prostate cancer. It is also reported to directly induce cancer cell apoptosis and indirectly modulate T-cell immune response as an antitumor agent. In this study, the effect of ZA following peptide/polyinosinic-polycytidylic acid (poly-IC) vaccination was investigated in a murine tumor model. The combination of ZA with peptide/poly-IC vaccine showed a synergistic effect on the induction of antigen-specific CD8 T-cell response. Three consecutive intravenous administrations of ZA was defined to induce the highest CD8 T-cell response. Further, total splenocyte counts and antigen-specific CD8 T-cell response gradually increased depending on the dose of ZA. In tumor-bearing mice, ZA showed a dose-dependent decrease of growth and prolonged survival. Treatment with ZA only decreased the number of CD11b(+)Gr1(+) myeloid cells in blood. Our results demonstrate that the use of ZA could improve antitumor immune responses induced by the peptide/poly-IC vaccine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Expression of p53 protein in advanced head and neck squamous cell carcinoma before and after chemotherapy.

    PubMed

    Dunphy, C H; Dunphy, F R; Boyd, J H; Varvares, M A; Kim, H J; Lowe, V; Dunleavy, T L; Rodriguez, J; McDonough, E M; Minster, J

    1997-11-01

    The expression of p53 protein has been reported to be in the range of 35% to 67% in head and neck squamous cell carcinoma (HNSCC). Mutations of the gene for p53 protein have been associated with rapidly proliferating tumors, and p53 protein expression has been shown to be a significant predictor of worse survival in surgically resected HNSCC. To determine whether p53 protein expression in advanced (stages III and IV) HNSCC has any impact on tumor response to 2 to 3 courses of paclitaxel (Taxol) and carboplatin, we prospectively studied prechemotherapy specimens from patients with previously untreated, advanced-stage HNSCC. We also attempted to study residual tumors after chemotherapy to determine if the p53 status of the tumor changed. The expression of p53 protein was evaluated by immunohistochemical analysis (clone BP53-12-1; Bio-Genex, San Ramon, Calif). Tertiary university medical center. Two to 3 courses of chemotherapy with paclitaxel and carboplatin. Pathologic complete remission or residual tumor. The results of p53 immunostaining were positive in 24 (67%) of 36 HNSCC specimens before chemotherapy. After chemotherapy, 8 patients achieved pathologic complete remission. Before chemotherapy, the tumor was p53 negative in 2 patients and positive in 6 patients. No correlation of p53 protein expression with response to chemotherapy was noted. The expression of p53 protein converted from positive to negative in 5 (42%) of 12 specimens from patients with residual tumor after chemotherapy, with no impact on clinical outcome.

  18. Type-specific and cross-reactive antibodies and T cell responses in norovirus VLP immunized mice are targeted both to conserved and variable domains of capsid VP1 protein.

    PubMed

    Malm, Maria; Tamminen, Kirsi; Vesikari, Timo; Blazevic, Vesna

    2016-10-01

    Norovirus (NoV)-specific antibodies, which block binding of the virus-like particles (VLPs) to the cell receptors are conformation dependent and directed towards the most exposed domain of the NoV capsid VP1 protein, the P2 domain. Limited data are available on the antibodies directed to other domains of the VP1, and even less on the NoV VP1-specific T cell epitopes. In here, BALB/c mice were immunized with six VLPs derived from NoV GII.4-1999, GII.4-2009 (New Orleans), GII.4-2012 (Sydney), GII.12, GI.1, and G1.3. Serum immunoglobulin G binding antibodies, histo-blood group antigen blocking antibodies and T cell responses using type-specific and heterologous NoV VLPs, P-dimers and 76 overlapping synthetic peptides, spanning the entire 539 amino acid sequence of GII.4 VP1, were determined. The results showed that at least half of the total antibody content is directed towards conserved S domain of the VP1. Only a small fraction (<1%) of the VP1 binding antibodies were blocking/neutralizing. With the use of matrix peptide pools and individual peptides, seven CD4 + and CD8 + T cell restricted epitopes were mapped, two located in S domain, four in P2 domain and one in P1 domain of NoV VP1. The epitopes were GII.4 strain-specific but also common GII.4 genotype-specific T cell epitopes were identified. More importantly, the results suggest a 9-amino acids long sequence ( 318 PAPLGTPDF 326 ) in P2 domain of VP1 as a universal NoV genogroup II-specific CD8 + T cell epitope. Distribution of the T cell epitopes alongside the capsid VP1 indicates the need of the complete protein for high immunogenicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  20. Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

    PubMed Central

    Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK