Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

PubMed

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Topological events in single molecules of E. coli DNA confined in nanochannels

PubMed Central

Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

2015-01-01

We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

2014-12-01

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

THE FORM AND STRUCTURE OF KINETOPLAST DNA OF CRITHIDIA

PubMed Central

Renger, Hartmut C.; Wolstenholme, David R.

1972-01-01

Cesium chloride centrifugation of each of the DNAs extracted from eight strains of Crithidia revealed a main band at ρ = 1.717 g/cm3 and a satellite band varying from ρ = 1.701 to 1.705 g/cm3 for the different strains By electron microscopy each DNA was shown to include circular molecules, 0.69–0.80 µ in mean contour length, and large, topologically two-dimensional masses of DNA in which the molecules appeared in the form of rosettes. DNA isolated from kinetoplast fractions of Crithidia acanthocephali was shown to consist of light satellite DNA and to be mainly in the form of large masses, 0.8 µ (mol wt = 1.54 x 106 daltons) circular molecules, and a few long, linear molecules. The results of experiments involving ultracentrifugation, heating, and quenching, sonication, and endodeoxyribonuclease digestion, combined with electron microscopy, are consistent with the following hypothesis. The large DNA masses are associations of 0.8 µ circles which are mainly covalently closed. The circles are held together in groups (the rosettes) of up to 46 by the topological interlocking of each circle with many other circles in the group. A group of circles is attached to an adjacent group by one or more circles, each interlocking with many circles of both groups. Each of the associations comprises, on the average, about 27,000 circles (total mol wt ≃ 41 x 109 daltons). A model is proposed for the in situ arrangement of the associations which takes into consideration their form and structure, and appearance in thin sections PMID:5040863

DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

PubMed

Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

2009-12-24

Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

NASA Astrophysics Data System (ADS)

Buyukdagli, Sahin

2017-02-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

MobB protein stimulates nicking at the R1162 origin of transfer by increasing the proportion of complexed plasmid DNA.

PubMed Central

Perwez, T; Meyer, R

1996-01-01

An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623

The colibactin warhead crosslinks DNA

NASA Astrophysics Data System (ADS)

Vizcaino, Maria I.; Crawford, Jason M.

2015-05-01

Members of the human microbiota are increasingly being correlated to human health and disease states, but the majority of the underlying microbial metabolites that regulate host-microbe interactions remain largely unexplored. Select strains of Escherichia coli present in the human colon have been linked to the initiation of inflammation-induced colorectal cancer through an unknown small-molecule-mediated process. The responsible non-ribosomal peptide-polyketide hybrid pathway encodes ‘colibactin’, which belongs to a largely uncharacterized family of small molecules. Genotoxic small molecules from this pathway that are capable of initiating cancer formation have remained elusive due to their high instability. Guided by metabolomic analyses, here we employ a combination of NMR spectroscopy and bioinformatics-guided isotopic labelling studies to characterize the colibactin warhead, an unprecedented substituted spirobicyclic structure. The warhead crosslinks duplex DNA in vitro, providing direct experimental evidence for colibactin's DNA-damaging activity. The data support unexpected models for both colibactin biosynthesis and its mode of action.

Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

PubMed

Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

2006-07-01

bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

Structure of nascent replicative form DNA of coliphage M13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta, S.; Mitra, S.

Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less

Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

PubMed

Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

2006-10-15

The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

Telomere Biology—Insights into an Intriguing Phenomenon

PubMed Central

Venkatesan, Shriram; Khaw, Aik Kia; Hande, Manoor Prakash

2017-01-01

Bacteria and viruses possess circular DNA, whereas eukaryotes with typically very large DNA molecules have had to evolve into linear chromosomes to circumvent the problem of supercoiling circular DNA of that size. Consequently, such organisms possess telomeres to cap chromosome ends. Telomeres are essentially tandem repeats of any DNA sequence that are present at the ends of chromosomes. Their biology has been an enigmatic one, involving various molecules interacting dynamically in an evolutionarily well-trimmed fashion. Telomeres range from canonical hexameric repeats in most eukaryotes to unimaginably random retrotransposons, which attach to chromosome ends and reverse-transcribe to DNA in some plants and insects. Telomeres invariably associate with specialised protein complexes that envelop it, also regulating access of the ends to legitimate enzymes involved in telomere metabolism. They also transcribe into repetitive RNA which also seems to be playing significant roles in telomere maintenance. Telomeres thus form the intersection of DNA, protein, and RNA molecules acting in concert to maintain chromosome integrity. Telomere biology is emerging to appear ever more complex than previously envisaged, with the continual discovery of more molecules and interplays at the telomeres. This review also includes a section dedicated to the history of telomere biology, and intends to target the scientific audience new to the field by rendering an understanding of the phenomenon of chromosome end protection at large, with more emphasis on the biology of human telomeres. The review provides an update on the field and mentions the questions that need to be addressed. PMID:28629193

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Going Vertical To Improve the Accuracy of Atomic Force Microscopy Based Single-Molecule Force Spectroscopy.

PubMed

Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T

2018-01-23

Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

PubMed

Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

2012-01-01

It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

Observation of Single-Protein and DNA Macromolecule Collisions on Ultramicroelectrodes.

PubMed

Dick, Jeffrey E; Renault, Christophe; Bard, Allen J

2015-07-08

Single-molecule detection is the ultimate sensitivity in analytical chemistry and has been largely unavailable in electrochemical analysis. Here, we demonstrate the feasibility of detecting electrochemically inactive single biomacromolecules, such as enzymes, antibodies, and DNA, by blocking a solution redox reaction when molecules adsorb and block electrode sites. By oxidizing a large concentration of potassium ferrocyanide on an ultramicroelectrode (UME, radius ≤150 nm), time-resolved, discrete adsorption events of antibodies, enzymes, DNA, and polystyrene nanospheres can be differentiated from the background by their "footprint". Further, by assuming that the mass transport of proteins to the electrode surface is controlled mainly by diffusion, a size estimate using the Stokes-Einstein relationship shows good agreement of electrochemical data with known protein sizes.

Molecular traffic jams on DNA.

PubMed

Finkelstein, Ilya J; Greene, Eric C

2013-01-01

All aspects of DNA metabolism-including transcription, replication, and repair-involve motor enzymes that move along genomic DNA. These processes must all take place on chromosomes that are occupied by a large number of other proteins. However, very little is known regarding how nucleic acid motor proteins move along the crowded DNA substrates that are likely to exist in physiological settings. This review summarizes recent progress in understanding how DNA-binding motor proteins respond to the presence of other proteins that lie in their paths. We highlight recent single-molecule biophysical experiments aimed at addressing this question, with an emphasis placed on analyzing the single-molecule, ensemble biochemical, and in vivo data from a mechanistic perspective.

Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.

PubMed

Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki

2016-11-29

DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265

May the Best Molecule Win: Competition ESI Mass Spectrometry

PubMed Central

Laughlin, Sarah; Wilson, W. David

2015-01-01

Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

PubMed

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

PubMed Central

Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

2017-01-01

Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

PubMed

Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less

A single thiazole orange molecule forms an exciplex in a DNA i-motif.

PubMed

Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

2014-06-18

A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

Multiplexed single-molecule force spectroscopy using a centrifuge.

PubMed

Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P

2016-03-17

We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.

Multiplexed single-molecule force spectroscopy using a centrifuge

PubMed Central

Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P.

2016-01-01

We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise. PMID:26984516

Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation

NASA Astrophysics Data System (ADS)

Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan

2015-08-01

Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.

In vitro molecular machine learning algorithm via symmetric internal loops of DNA.

PubMed

Lee, Ji-Hoon; Lee, Seung Hwan; Baek, Christina; Chun, Hyosun; Ryu, Je-Hwan; Kim, Jin-Woo; Deaton, Russell; Zhang, Byoung-Tak

2017-08-01

Programmable biomolecules, such as DNA strands, deoxyribozymes, and restriction enzymes, have been used to solve computational problems, construct large-scale logic circuits, and program simple molecular games. Although studies have shown the potential of molecular computing, the capability of computational learning with DNA molecules, i.e., molecular machine learning, has yet to be experimentally verified. Here, we present a novel molecular learning in vitro model in which symmetric internal loops of double-stranded DNA are exploited to measure the differences between training instances, thus enabling the molecules to learn from small errors. The model was evaluated on a data set of twenty dialogue sentences obtained from the television shows Friends and Prison Break. The wet DNA-computing experiments confirmed that the molecular learning machine was able to generalize the dialogue patterns of each show and successfully identify the show from which the sentences originated. The molecular machine learning model described here opens the way for solving machine learning problems in computer science and biology using in vitro molecular computing with the data encoded in DNA molecules. Copyright © 2017. Published by Elsevier B.V.

Laser microtreatment for genetic manipulations and DNA diagnostics by a combination of microbeam and photonic tweezers (laser microbeam trap)

NASA Astrophysics Data System (ADS)

Greulich, Karl-Otto; Monajembashi, Shamci; Celeda, D.; Endlich, N.; Eickhoff, Holger; Hoyer, Carsten; Leitz, G.; Weber, Gerd; Scheef, J.; Rueterjans, H.

1994-12-01

Genomes of higher organisms are larger than one typically expects. For example, the DNA of a single human cell is almost two meters long, the DNA in the human body covers the distance Earth-Sun approximately 140 times. This is often not considered in typical molecular biological approaches for DNA diagnostics, where usually only DNA of the length of a gene is investigated. Also, one basic aspect of sequencing the human genome is not really solved: the problem how to prepare the huge amounts of DNA required. Approaches from biomedical optics combined with new developments in single molecule biotechnology may at least contribute some parts of the puzzle. A large genome can be partitioned into portions comprising approximately 1% of the whole DNA using a laser microbeam. The single DNA fragment can be amplified by the polymerase chain reaction in order to obtain a sufficient amount of molecules for conventional DNA diagnostics or for analysis by octanucleotide hybridization. When not amplified by biotechnological processes, the individual DNA molecule can be visualized in the light microscope and can be manipulated and dissected with the laser microbeam trap. The DNA probes obtained by single molecule biotechnology can be employed for fluorescence in situ introduced into plant cells and subcellular structures even when other techniques fail. Since the laser microbeam trap allows to work in the interior of a cell without opening it, subcellular structures can be manipulated. For example, in algae, such structures can be moved out of their original position and used to study intracellular viscosities.

Studies on the accessibility of deoxyribonucleic acid in deoxyribonucleoprotein to cationic molecules

PubMed Central

Itzhaki, Ruth F.

1971-01-01

The binding of deoxyribonucleoprotein to Toluidine Blue, to cetylpyridinium chloride and to polylysine of various molecular weights was studied to determine the percentage of free DNA phosphate groups in deoxyribonucleoprotein. Binding was measured by addition of these reagents to deoxyribonucleoprotein at a range of concentrations such that complete precipitation of the deoxyribonucleoprotein occurred. With Toluidine Blue the binding corresponded to about 48% of the DNA phosphates in deoxyribonucleoprotein. The dye did not cause appreciable displacement of protein from the DNA. With cetylpyridinium chloride the binding corresponded to about 41% of the DNA phosphates. With polylysine preparations of molecular weight 1250 and 7790 the binding values for deoxyribonucleoprotein were 46 and 38% respectively. The results suggest that the free phosphates lie in stretches sufficiently long to accommodate most of each polylysine molecule. With polylysine of molecular weight 62000 cross-linking of free stretches of DNA on different deoxyribonucleoprotein molecules probably occurs. It is concluded that although most of the free phosphates are probably `hidden' beneath covering histone, corresponding perhaps to runs of non-basic residues in the latter, they are surprisingly accessible to very large molecules. The relevance of this finding to the problem of gene repression is discussed. PMID:5166331

Dendritic silica nanomaterials (KCC-1) with fibrous pore structure possess high DNA adsorption capacity and effectively deliver genes in vitro.

PubMed

Huang, Xiaoxi; Tao, Zhimin; Praskavich, John C; Goswami, Anandarup; Al-Sharab, Jafar F; Minko, Tamara; Polshettiwar, Vivek; Asefa, Tewodros

2014-09-16

The pore size and pore structure of nanoporous materials can affect the materials' physical properties, as well as potential applications in different areas, including catalysis, drug delivery, and biomolecular therapeutics. KCC-1, one of the newest members of silica nanomaterials, possesses fibrous, large pore, dendritic pore networks with wide pore entrances, large pore size distribution, spacious pore volume and large surface area--structural features that are conducive for adsorption and release of large guest molecules and biomacromolecules (e.g., proteins and DNAs). Here, we report the results of our comparative studies of adsorption of salmon DNA in a series of KCC-1-based nanomaterials that are functionalized with different organoamine groups on different parts of their surfaces (channel walls, external surfaces or both). For comparison the results of our studies of adsorption of salmon DNA in similarly functionalized, MCM-41 mesoporous silica nanomaterials with cylindrical pores, some of the most studied silica nanomaterials for drug/gene delivery, are also included. Our results indicate that, despite their relatively lower specific surface area, the KCC-1-based nanomaterials show high adsorption capacity for DNA than the corresponding MCM-41-based nanomaterials, most likely because of KCC-1's large pores, wide pore mouths, fibrous pore network, and thereby more accessible and amenable structure for DNA molecules to diffuse through. Conversely, the MCM-41-based nanomaterials adsorb much less DNA, presumably because their outer surfaces/cylindrical channel pore entrances can get blocked by the DNA molecules, making the inner parts of the materials inaccessible. Moreover, experiments involving fluorescent dye-tagged DNAs suggest that the amine-grafted KCC-1 materials are better suited for delivering the DNAs adsorbed on their surfaces into cellular environments than their MCM-41 counterparts. Finally, cellular toxicity tests show that the KCC-1-based materials are biocompatible. On the basis of these results, the fibrous and porous KCC-1-based nanomaterials can be said to be more suitable to carry, transport, and deliver DNAs and genes than cylindrical porous nanomaterials such as MCM-41.

Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

PubMed

Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

2012-01-03

We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society

Dynamics of single-stranded DNA tethered to a solid

NASA Astrophysics Data System (ADS)

Radiom, Milad; Paul, Mark R.; Ducker, William A.

2016-06-01

Tethering is used to deliver specific biological and industrial functions. For example, single-stranded DNA (ssDNA) is tethered to polymerases and long sequences of double-stranded DNA (dsDNA) during replication, and to solids in DNA microarrays. However, tethering ssDNA to a large object limits not only the available ssDNA conformations, but also the range of time-scales over which the mechanical responses of ssDNA are important. In this work we examine the effect of tethering by measurement of the mechanical response of ssDNA that is tethered at each end to two separate atomic force microscope cantilevers in aqueous solution. Thermal motion of the cantilevers drives the ends of the ssDNA chain at frequencies near 2 kHz. The presence of a tethered molecule makes a large difference to the asymmetric cross-correlation of two cantilevers, which enables resolution of the mechanical properties in our experiments. By analysis of the correlated motion of the cantilevers we extract the friction and stiffness of the ssDNA. We find that the measured friction is much larger than the friction that is usually associated with the unencumbered motion of ssDNA. We also find that the measured relaxation time, ∼30 μs, is much greater than prior measurements of the free-molecule relaxation time. We attribute the difference to the loss of conformational possibilities as a result of constraining the ends of the ssDNA.

Adsorption of plasmid DNA on anion exchange chromatography media.

PubMed

Tarmann, Christina; Jungbauer, Alois

2008-08-01

Anion exchange chromatography (AEC) is a useful and effective tool for DNA purification, but due to average pore sizes between 40 and 100 nm most AEC resins lack truly useful binding capacities for plasmid DNA (pDNA). Equilibrium binding capacities and uptake kinetics of AEC media including conventional media (Source 30 Q, Q Sepharose HP), a polymer grafted medium (Fractogel EMD DEAE (M)), media with large pores (Celbeads DEAE, PL SAX 4000 A 30 microm) and a monolithic medium (CIM-DEAE) were investigated by batch uptake or shallow bed experiments at two salt concentrations. Theoretical and experimental binding capacities suggest that the shape of the pDNA molecule can be described by a rod with a length to diameter ratio of 20:1 and that the molecule binds in upright position. The arrangement of DNA like a brush at the surface can be considered as entropy driven, kind of self-assembly process which is inherent to highly and uniformly charged DNA molecules. The initial phase of adsorption is very fast and levels off, associated with a change in mass transfer mechanism. Feed concentrations higher than 0.1 mg/mL pDNA pronounce this effect. Monolithic media showed the fastest adsorption rate and highest binding capacity with 13 mg pDNA per mL.

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE PAGES

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

2017-01-16

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

High-throughput single-molecule telomere characterization.

PubMed

McCaffrey, Jennifer; Young, Eleanor; Lassahn, Katy; Sibert, Justin; Pastor, Steven; Riethman, Harold; Xiao, Ming

2017-11-01

We have developed a novel method that enables global subtelomere and haplotype-resolved analysis of telomere lengths at the single-molecule level. An in vitro CRISPR/Cas9 RNA-directed nickase system directs the specific labeling of human (TTAGGG)n DNA tracts in genomes that have also been barcoded using a separate nickase enzyme that recognizes a 7-bp motif genome-wide. High-throughput imaging and analysis of large DNA single molecules from genomes labeled in this fashion using a nanochannel array system permits mapping through subtelomere repeat element (SRE) regions to unique chromosomal DNA while simultaneously measuring the (TTAGGG)n tract length at the end of each large telomere-terminal DNA segment. The methodology also permits subtelomere and haplotype-resolved analyses of SRE organization and variation, providing a window into the population dynamics and potential functions of these complex and structurally variant telomere-adjacent DNA regions. At its current stage of development, the assay can be used to identify and characterize telomere length distributions of 30-35 discrete telomeres simultaneously and accurately. The assay's utility is demonstrated using early versus late passage and senescent human diploid fibroblasts, documenting the anticipated telomere attrition on a global telomere-by-telomere basis as well as identifying subtelomere-specific biases for critically short telomeres. Similarly, we present the first global single-telomere-resolved analyses of two cancer cell lines. © 2017 McCaffrey et al.; Published by Cold Spring Harbor Laboratory Press.

Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics

NASA Astrophysics Data System (ADS)

Pandey, Harsh; Underhill, Patrick T.

2015-11-01

The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander M.; Benson, Scott C.

1999-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander M.; Benson, Scott C.

1998-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1995-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1997-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

PubMed

Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

2012-01-01

Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

Modification of the coil-stretch transition by confinement

NASA Astrophysics Data System (ADS)

Doyle, Patick; Tang, Jing; Jones, Jeremy

2010-03-01

Large double stranded DNA are both a powerful system to study polymer dynamics at the single molecule level and also important molecules for genomic applications. While homogenous electric fields are routinely used to separate DNA in gels, DNA deformation in more complex fields has been less widely studied. We will demonstrate how micro/nanofluidic devices allow for the generation of electric fields with well-defined kinematics for trapping, stretching and then watching DNA relax back to equilibrium. The dimensions of the devices highly confine DNA and subsequently change both their conformation and dynamics. We will show how these confinements effects change the coil-stretch transition of a DNA being electrophoretically stretched in a purely elongational electrical field. We experimentally show that a two-stage coil stretch transition occurs and develop a simple dumbbell model which captures most of the relevant physics. We trace the origin of this phenomena to the modification of the effective spring law due to confinement.

Comparison of the Single Molecule Dynamics of Linear and Circular DNAs in Planar Extensional Flows

NASA Astrophysics Data System (ADS)

Li, Yanfei; Hsiao, Kai-Wen; Brockman, Christopher; Yates, Daniel; McKenna, Gregory; Schroeder, Charles; San Francisco, Michael; Kornfield, Julie; Anderson, Rae

2015-03-01

Chain topology has a profound impact on the flow behaviors of single macromolecules. The absence of free ends separates circular polymers from other chain architectures, i.e., linear, star, and branched. In the present work, we study the single chain dynamics of large circular and linear DNA molecules by comparing the relaxation dynamics, steady state coil-stretch transition, and transient molecular individualism behaviors for the two types of macromolecules. To this end, large circular DNA molecules were biologically synthesized and studied in a microfluidic device that has a cross-slot geometry to develop a stagnation point extensional flow. Although the relaxation time of rings scales in the same way as for the linear analog, the circular polymers show quantitatively different behaviors in the steady state extension and qualitatively different behaviors during a transient stretch. The existence of some commonality between these two topologies is proposed. Texas Tech University John R. Bradford Endowment.

Atomic-scale imaging of DNA using scanning tunnelling microscopy.

PubMed

Driscoll, R J; Youngquist, M G; Baldeschwieler, J D

1990-07-19

The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.

Evaluation of genotoxicity testing of FDA approved large molecule therapeutics.

PubMed

Sawant, Satin G; Fielden, Mark R; Black, Kurt A

2014-10-01

Large molecule therapeutics (MW>1000daltons) are not expected to enter the cell and thus have reduced potential to interact directly with DNA or related physiological processes. Genotoxicity studies are therefore not relevant and typically not required for large molecule therapeutic candidates. Regulatory guidance supports this approach; however there are examples of marketed large molecule therapeutics where sponsors have conducted genotoxicity studies. A retrospective analysis was performed on genotoxicity studies of United States FDA approved large molecule therapeutics since 1998 identified through the Drugs@FDA website. This information was used to provide a data-driven rationale for genotoxicity evaluations of large molecule therapeutics. Fifty-three of the 99 therapeutics identified were tested for genotoxic potential. None of the therapeutics tested showed a positive outcome in any study except the peptide glucagon (GlucaGen®) showing equivocal in vitro results, as stated in the product labeling. Scientific rationale and data from this review indicate that testing of a majority of large molecule modalities do not add value to risk assessment and support current regulatory guidance. Similarly, the data do not support testing of peptides containing only natural amino acids. Peptides containing non-natural amino acids and small molecules in conjugated products may need to be tested. Copyright © 2014 Elsevier Inc. All rights reserved.

The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

NASA Astrophysics Data System (ADS)

Ashhadi, M.

2018-07-01

We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems

PubMed Central

Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.

2008-01-01

We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194

Regulation of DNA conformations and dynamics in flows with hybrid field microfluidics.

PubMed

Ren, Fangfang; Zu, Yingbo; Kumar Rajagopalan, Kartik; Wang, Shengnian

2012-01-01

Visualizing single DNA dynamics in flow provides a wealth of physical insights in biophysics and complex flow study. However, large signal fluctuations, generated from diversified conformations, deformation history dependent dynamics and flow induced stochastic tumbling, often frustrate its wide adoption in single molecule and polymer flow study. We use a hybrid field microfluidic (HFM) approach, in which an electric field is imposed at desired locations and appropriate moments to balance the flow stress on charged molecules, to effectively regulate the initial conformations and the deformation dynamics of macromolecules in flow. With λ-DNA and a steady laminar shear flow as the model system, we herein studied the performance of HFM on regulating DNA trapping, relaxation, coil-stretch transition, and accumulation. DNA molecules were found to get captured in the focused planes when motions caused by flow, and the electric field were balanced. The trapped macromolecules relaxed in two different routes while eventually became more uniform in size and globule conformations. When removing the electric field, the sudden stretching dynamics of DNA molecules exhibited a more pronounced extension overshoot in their transient response under a true step function of flow stress while similar behaviors to what other pioneering work in steady shear flow. Such regulation strategies could be useful to control the conformations of other important macromolecules (e.g., proteins) and help better reveal their molecular dynamics.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

PubMed

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

NASA Astrophysics Data System (ADS)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.N.; Benson, S.C.

1997-07-08

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.M.; Benson, S.C.

1998-06-16

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.N.; Benson, S.C.

1995-03-28

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figures.

Single-molecule optical genome mapping of a human HapMap and a colorectal cancer cell line.

PubMed

Teo, Audrey S M; Verzotto, Davide; Yao, Fei; Nagarajan, Niranjan; Hillmer, Axel M

2015-01-01

Next-generation sequencing (NGS) technologies have changed our understanding of the variability of the human genome. However, the identification of genome structural variations based on NGS approaches with read lengths of 35-300 bases remains a challenge. Single-molecule optical mapping technologies allow the analysis of DNA molecules of up to 2 Mb and as such are suitable for the identification of large-scale genome structural variations, and for de novo genome assemblies when combined with short-read NGS data. Here we present optical mapping data for two human genomes: the HapMap cell line GM12878 and the colorectal cancer cell line HCT116. High molecular weight DNA was obtained by embedding GM12878 and HCT116 cells, respectively, in agarose plugs, followed by DNA extraction under mild conditions. Genomic DNA was digested with KpnI and 310,000 and 296,000 DNA molecules (≥ 150 kb and 10 restriction fragments), respectively, were analyzed per cell line using the Argus optical mapping system. Maps were aligned to the human reference by OPTIMA, a new glocal alignment method. Genome coverage of 6.8× and 5.7× was obtained, respectively; 2.9× and 1.7× more than the coverage obtained with previously available software. Optical mapping allows the resolution of large-scale structural variations of the genome, and the scaffold extension of NGS-based de novo assemblies. OPTIMA is an efficient new alignment method; our optical mapping data provide a resource for genome structure analyses of the human HapMap reference cell line GM12878, and the colorectal cancer cell line HCT116.

Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Stasiak, Andrzej

2016-09-01

Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

Vibronic dephasing model for coherent-to-incoherent crossover in DNA

NASA Astrophysics Data System (ADS)

Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

2018-05-01

In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

Molecular transport through large-diameter DNA nanopores

NASA Astrophysics Data System (ADS)

Krishnan, Swati; Ziegler, Daniela; Arnaut, Vera; Martin, Thomas G.; Kapsner, Korbinian; Henneberg, Katharina; Bausch, Andreas R.; Dietz, Hendrik; Simmel, Friedrich C.

2016-09-01

DNA-based nanopores are synthetic biomolecular membrane pores, whose geometry and chemical functionality can be tuned using the tools of DNA nanotechnology, making them promising molecular devices for applications in single-molecule biosensing and synthetic biology. Here we introduce a large DNA membrane channel with an ~4 nm diameter pore, which has stable electrical properties and spontaneously inserts into flat lipid bilayer membranes. Membrane incorporation is facilitated by a large number of hydrophobic functionalizations or, alternatively, streptavidin linkages between biotinylated channels and lipids. The channel displays an Ohmic conductance of ~3 nS, consistent with its size, and allows electrically driven translocation of single-stranded and double-stranded DNA analytes. Using confocal microscopy and a dye influx assay, we demonstrate the spontaneous formation of membrane pores in giant unilamellar vesicles. Pores can be created both in an outside-in and an inside-out configuration.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Large-scale DNA Barcode Library Generation for Biomolecule Identification in High-throughput Screens.

PubMed

Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio

2017-10-24

High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.

Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

PubMed Central

Robinson, Clifford R.; Sligar, Stephen G.

1998-01-01

Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

Measurement of inelastic cross sections for low-energy electron scattering from DNA bases.

PubMed

Michaud, Marc; Bazin, Marc; Sanche, Léon

2012-01-01

To determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Electron energy loss (EEL) spectra of DNA bases were recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra were then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes were finally obtained from computing the area under the corresponding Gaussians. The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV were reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. The CS for electronic excitations of DNA bases by LEE impact were found to lie within the 10(216) to 10(218) cm(2) range. The large value of the total ionisation CS indicated that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA.

Measurement of inelastic cross sections for low-energy electron scattering from DNA bases

PubMed Central

Michaud, Marc; Bazin, Marc.; Sanche, Léon

2013-01-01

Purpose Determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Materials and methods Electron energy loss (EEL) spectra of DNA bases are recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra are then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes are finally obtained from computing the area under the corresponding Gaussians. Results The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV are reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. Conclusions The CS for electronic excitations of DNA bases by LEE impact are found to lie within the 10−16 – 10−18 cm2 range. The large value of the total ionisation CS indicates that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA. PMID:21615242

Mapping the yeast genome by melting in nanofluidic devices

NASA Astrophysics Data System (ADS)

Welch, Robert L.; Czolkos, Ilja; Sladek, Rob; Reisner, Walter

2012-02-01

Optical mapping of DNA provides large-scale genomic information that can be used to assemble contigs from next-generation sequencing, and to detect re-arrangements between single cells. A recent optical mapping technique called denaturation mapping has the unique advantage of using physical principles rather than the action of enzymes to probe genomic structure. The absence of reagents or reaction steps makes denaturation mapping simpler than other protocols. Denaturation mapping uses fluorescence microscopy to image the pattern of partial melting along a DNA molecule extended in a channel of cross-section ˜100nm at the heart of a nanofluidic device. We successfully aligned melting maps from single DNA molecules to a theoretical map of the yeast genome (11.6Mbp) to identify their location. By aligning hundreds of molecules we assembled a consensus melting map of the yeast genome with 95% coverage.

Long-range barcode labeling-sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Feng; Zhang, Tao; Singh, Kanwar K.

Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

Equilibrium softening of an enzyme explored with the DNA spring

NASA Astrophysics Data System (ADS)

Tseng, Chiao-Yu; Zocchi, Giovanni

2014-04-01

We explore enzyme mechanics using a system of two mechanically coupled biomolecules. Measurements of the mechanical modulation of enzymatic activity in a Luciferase—DNA chimera are presented. These are molecules where the enzyme is deformed by the action of a DNA spring. The response of the enzyme for different states of stress is examined. It is found that small changes in the stress cause large changes in activity. This nonlinear behavior is qualitatively interpreted as arising from a soft regime of the enzyme beyond linear elasticity. This soft regime may enable large conformational motion in enzymes.

Novel Technology for Enrichment of Biomolecules from Cell-Free Body Fluids and Subsequent DNA Sizing.

PubMed

Patel, Vipulkumar; Celec, Peter; Grunt, Magdalena; Schwarzenbach, Heidi; Jenneckens, Ingo; Hillebrand, Timo

2016-01-01

Circulating cell-free DNA (ccfDNA) is a promising diagnostic tool and its size fractionation is of interest. However, kits for isolation of ccfDNA available on the market are designed for small volumes hence processing large sample volumes is laborious. We have tested a new method that enables enrichment of ccfDNA from large volumes of plasma and subsequently allows size-fractionation of isolated ccfDNA into two fractions with individually established cut-off levels of ccfDNA length. This method allows isolation of low-abundant DNA as well as separation of long and short DNA molecules. This procedure may be important e.g., in prenatal diagnostics and cancer research that have been already confirmed by our primary experiments. Here, we report the results of selective separation of 200- and 500-bp long synthetic DNA fragments spiked in plasma samples. Furthermore, we size-fractionated ccfDNA from the plasma of pregnant women and verified the prevalence of fetal ccfDNA in all fractions.

A size selective porous silicon grating-coupled Bloch surface and sub-surface wave biosensor.

PubMed

Rodriguez, Gilberto A; Ryckman, Judson D; Jiao, Yang; Weiss, Sharon M

2014-03-15

A porous silicon (PSi) grating-coupled Bloch surface and sub-surface wave (BSW/BSSW) biosensor is demonstrated to size selectively detect the presence of both large and small molecules. The BSW is used to sense large immobilized analytes at the surface of the structure while the BSSW that is confined inside but near the top of the structure is used to sensitively detect small molecules. Functionality of the BSW and BSSW modes is theoretically described by dispersion relations, field confinements, and simulated refractive index shifts within the structure. The theoretical results are experimentally verified by detecting two different small chemical molecules and one large 40 base DNA oligonucleotide. The PSi-BSW/BSSW structure is benchmarked against current porous silicon technology and is shown to have a 6-fold higher sensitivity in detecting large molecules and a 33% improvement in detecting small molecules. This is the first report of a grating-coupled BSW biosensor and the first report of a BSSW propagating mode. © 2013 Published by Elsevier B.V.

Molecular Precision at Micrometer Length Scales: Hierarchical Assembly of DNA-Protein Nanostructures.

PubMed

Schiffels, Daniel; Szalai, Veronika A; Liddle, J Alexander

2017-07-25

Robust self-assembly across length scales is a ubiquitous feature of biological systems but remains challenging for synthetic structures. Taking a cue from biology-where disparate molecules work together to produce large, functional assemblies-we demonstrate how to engineer microscale structures with nanoscale features: Our self-assembly approach begins by using DNA polymerase to controllably create double-stranded DNA (dsDNA) sections on a single-stranded template. The single-stranded DNA (ssDNA) sections are then folded into a mechanically flexible skeleton by the origami method. This process simultaneously shapes the structure at the nanoscale and directs the large-scale geometry. The DNA skeleton guides the assembly of RecA protein filaments, which provides rigidity at the micrometer scale. We use our modular design strategy to assemble tetrahedral, rectangular, and linear shapes of defined dimensions. This method enables the robust construction of complex assemblies, greatly extending the range of DNA-based self-assembly methods.

Cell transformation mediated by chromosomal deoxyribonucleic acid of polyoma virus-transformed cells.

PubMed Central

Della Valle, G; Fenton, R G; Basilico, C

1981-01-01

To study the mechanism of deoxyribonucleic acid (DNA)-mediated gene transfer, normal rat cells were transfected with total cellular DNA extracted from polyoma virus-transformed cells. This resulted in the appearance of the transformed phenotype in 1 X 10(-6) to 3 X 10(-6) of the transfected cells. Transformation was invariably associated with the acquisition of integrated viral DNA sequences characteristic of the donor DNA. This was caused not by the integration of free DNA molecules, but by the transfer of large DNA fragments (10 to 20 kilobases) containing linked cellular and viral sequences. Although Southern blot analysis showed that integration did not appear to occur in a homologous region of the recipient chromosome, the frequency of transformation was rather high when compared with that of purified polyoma DNA, perhaps due to "position" effects or to the high efficiency of recombination of large DNA fragments. Images PMID:6100965

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

PubMed Central

Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

2015-01-01

Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

Topology simplification: Important biological phenomenon or evolutionary relic?. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Bates, Andrew D.; Maxwell, Anthony

2016-09-01

The review, Disentangling DNA molecules[1], gives an excellent technical description of the phenomenon of topology simplification (TS) by type IIA DNA topoisomerases (topos). In the 20 years since its discovery [2], this effect has attracted a good deal of attention, probably because of its apparently magical nature, and because it seemed to offer a solution to the conundrum that all type II topos rely on ATP hydrolysis, but only bacterial DNA gyrases were known to transduce the free energy of hydrolysis into torsion (supercoiling) in the DNA. It made good sense to think that the other enzymes are using the energy to reduce the level of supercoiling, knotting, and particularly decatenation (unlinking), below equilibrium, since the key activity of the non-supercoiling topos is the removal of links between daughter chromosomes [3]. As Vologodskii discusses [1], there have been a number of theoretical models developed to explain how the local effect of a type II topo can influence the global level of knotting and catenation in large DNA molecules, and he explains how features of two of the most successful models (bent G segment and hooked juxtapositions) may be combined to explain the magnitude of the effect and overcome a kinetic problem with the hooked juxtaposition model.

Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

PubMed

El-Diasty, Fouad; Abdel-Wahab, Fathy

2015-10-01

The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.

Incorporation of excess wild-type and mutant tRNA(3Lys) into human immunodeficiency virus type 1.

PubMed Central

Huang, Y; Mak, J; Cao, Q; Li, Z; Wainberg, M A; Kleiman, L

1994-01-01

Human immunodeficiency virus (HIV) particles produced in COS-7 cells transfected with HIV type 1 (HIV-1) proviral DNA contain 8 molecules of tRNA(3Lys) per 2 molecules of genomic RNA and 12 molecules of tRNA1,2Lys per 2 molecules of genomic RNA. When COS-7 cells are transfected with a plasmid containing both HIV-1 proviral DNA and a human tRNA3Lys gene, there is a large increase in the amount of cytoplasmic tRNA3Lys per microgram of total cellular RNA, and the tRNA3Lys content in the virus increases from 8 to 17 molecules per 2 molecules of genomic RNA. However, the total number of tRNALys molecules per 2 molecules of genomic RNA remains constant at 20; i.e., the viral tRNA1,2Lys content decreases from 12 to 3 molecules per 2 molecules of genomic RNA. All detectable tRNA3Lys is aminoacylated in the cytoplasm of infected cells and deacylated in the virus. When COS-7 cells are transfected with a plasmid containing both HIV-1 proviral DNA and a mutant amber suppressor tRNA3Lys gene (in which the anticodon is changed from TTT to CTA), there is also a large increase in the relative concentration of cytoplasmic tRNA3Lys, and the tRNA3Lys content in the virus increases from 8 to 15 molecules per 2 molecules of genomic RNA, with a decrease in viral tRNA1,2Lys from 12 to 5 molecules per 2 molecules of genomic RNA. Thus, the total number of molecules of tRNALys in the virion remains at 20. The alteration of the anticodon has little effect on the viral packaging of this mutant tRNA in spite of the fact that it no longer contains the modified base mcm 5s2U at position 34, and its ability to be aminoacylated is significantly impaired compared with that of wild-type tRNA3Lys. Viral particles which have incorporated either excess wild-type tRNA3Lys or mutant suppressor tRNA3Lys show no differences in viral infectivity compared with wild-type HIV-1. Images PMID:7966556

The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.

PubMed

O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R

2017-10-17

Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure-a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery-imagine being able to evolve molecules for light harvesting, or catalysts for CO 2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous "DNA robots" have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution.

The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery

PubMed Central

2017-01-01

Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure—a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery—imagine being able to evolve molecules for light harvesting, or catalysts for CO2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous “DNA robots” have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution. PMID:28915003

Mitochondrial genome of the freshwater jellyfish Craspedacusta sowerbyi and phylogenetics of Medusozoa.

PubMed

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa, Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa.

Mitochondrial Genome of the Freshwater Jellyfish Craspedacusta sowerbyi and Phylogenetics of Medusozoa

PubMed Central

Zou, Hong; Zhang, Jin; Li, Wenxiang; Wu, Shangong; Wang, Guitang

2012-01-01

The 17,922 base pairs (bp) nucleotide sequence of the linear mitochondrial DNA (mtDNA) molecule of the freshwater jellyfish Craspedacusta sowerbyi (Hydrozoa,Trachylina, Limnomedusae) has been determined. This sequence exhibits surprisingly low A+T content (57.1%), containing genes for 13 energy pathway proteins, a small and a large subunit rRNAs, and methionine and tryptophan tRNAs. Mitochondrial ancestral medusozoan gene order (AMGO) was found in the C. sowerbyi, as those found in Cubaia aphrodite (Hydrozoa, Trachylina, Limnomedusae), discomedusan Scyphozoa and Staurozoa. The genes of C. sowerbyi mtDNA are arranged in two clusters with opposite transcriptional polarities, whereby transcription proceeds toward the ends of the DNA molecule. Identical inverted terminal repeats (ITRs) flank the ends of the mitochondrial DNA molecule, a characteristic typical of medusozoans. In addition, two open reading frames (ORFs) of 354 and 1611 bp in length were found downstream of the large subunit rRNA gene, similar to the two ORFs of ORF314 and polB discovered in the linear mtDNA of C. aphrodite, discomedusan Scyphozoa and Staurozoa. Phylogenetic analyses of C. sowerbyi and other cnidarians were carried out based on both nucleotide and inferred amino acid sequences of the 13 mitochondrial energy pathway genes. Our working hypothesis supports the monophyletic Medusozoa being a sister group to Octocorallia (Cnidaria, Anthozoa). Within Medusozoa, the phylogenetic analysis suggests that Staurozoa may be the earliest diverging class and the sister group of all other medusozoans. Cubozoa and coronate Scyphozoa form a clade that is the sister group of Hydrozoa plus discomedusan Scyphozoa. Hydrozoa is the sister group of discomedusan Scyphozoa. Semaeostomeae is a paraphyletic clade with Rhizostomeae, while Limnomedusae (Trachylina) is the sister group of hydroidolinans and may be the earliest diverging lineage among Hydrozoa. PMID:23240028

Circular replication-associated protein encoding DNA viruses identified in the faecal matter of various animals in New Zealand.

PubMed

Steel, Olivia; Kraberger, Simona; Sikorski, Alyssa; Young, Laura M; Catchpole, Ryan J; Stevens, Aaron J; Ladley, Jenny J; Coray, Dorien S; Stainton, Daisy; Dayaram, Anisha; Julian, Laurel; van Bysterveldt, Katherine; Varsani, Arvind

2016-09-01

In recent years, innovations in molecular techniques and sequencing technologies have resulted in a rapid expansion in the number of known viral sequences, in particular those with circular replication-associated protein (Rep)-encoding single-stranded (CRESS) DNA genomes. CRESS DNA viruses are present in the virome of many ecosystems and are known to infect a wide range of organisms. A large number of the recently identified CRESS DNA viruses cannot be classified into any known viral families, indicating that the current view of CRESS DNA viral sequence space is greatly underestimated. Animal faecal matter has proven to be a particularly useful source for sampling CRESS DNA viruses in an ecosystem, as it is cost-effective and non-invasive. In this study a viral metagenomic approach was used to explore the diversity of CRESS DNA viruses present in the faeces of domesticated and wild animals in New Zealand. Thirty-eight complete CRESS DNA viral genomes and two circular molecules (that may be defective molecules or single components of multicomponent genomes) were identified from forty-nine individual animal faecal samples. Based on shared genome organisations and sequence similarities, eighteen of the isolates were classified as gemycircularviruses and twelve isolates were classified as smacoviruses. The remaining eight isolates lack significant sequence similarity with any members of known CRESS DNA virus groups. This research adds significantly to our knowledge of CRESS DNA viral diversity in New Zealand, emphasising the prevalence of CRESS DNA viruses in nature, and reinforcing the suggestion that a large proportion of CRESS DNA viruses are yet to be identified. Copyright © 2016 Elsevier B.V. All rights reserved.

Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

NASA Astrophysics Data System (ADS)

Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

2013-05-01

Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

NASA Astrophysics Data System (ADS)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores.

PubMed

Bell, Nicholas A W; Keyser, Ulrich F

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

PubMed Central

Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

2014-01-01

As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

Isothermal assembly of DNA origami structures using denaturing agents.

PubMed

Jungmann, Ralf; Liedl, Tim; Sobey, Thomas L; Shih, William; Simmel, Friedrich C

2008-08-06

DNA origami is one of the most promising recent developments in DNA self-assembly. It allows for the construction of arbitrary nanoscale patterns and objects by folding a long viral scaffold strand using a large number of short "staple" strands. Assembly is usually accomplished by thermal annealing of the DNA molecules in buffer solution. We here demonstrate that both 2D and 3D origami structures can be assembled isothermally by annealing the DNA strands in denaturing buffer, followed by a controlled reduction of denaturant concentration. This opens up origami assembly for the integration of temperature-sensitive components.

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

PubMed

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Deformation of DNA molecules by hydrodynamic focusing

NASA Astrophysics Data System (ADS)

Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

2003-12-01

The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

PubMed

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

PubMed

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Single-molecule studies of multi-protein machines

NASA Astrophysics Data System (ADS)

van Oijen, Antoine

2010-03-01

Advances in optical imaging and molecular manipulation techniques have made it possible to observe individual enzymes and record molecular movies that provide new insight into their dynamics and reaction mechanisms. In a biological context, most of these enzymes function in concert with other enzymes in multi-protein complexes, so an important future direction will be the utilization of single-molecule techniques to unravel the orchestration of large macromolecular assemblies. Our group is developing the single-molecule tools that will make it possible to study biochemical pathways of arbitrary complexity at the single-molecule level. I will discuss results of single-molecule experiments on the replisome, the molecular machinery that is responsible for replication of DNA. We stretch individual DNA molecules and use their elastic properties to obtain dynamic information on the proteins that unwind the double helix and copy its genetic information. Furthermore, we visualize fluorescently labeled components of the replisome and thus obtain information on stochiometry and exchange kinetics. This simultaneous observation of catalytic activity and composition allows us to gain deeper insight into the structure-function relationship of the replisome.

Delivery of large biopharmaceuticals from cardiovascular stents: a review

PubMed Central

Takahashi, Hironobu; Letourneur, Didier; Grainger, David W.

2008-01-01

This review focuses on the new and emerging large-molecule bioactive agents delivered from stent surfaces in drug-eluting stents (DES) to inhibit vascular restenosis in the context of interventional cardiology. New therapeutic agents representing proteins, nucleic acids (small interfering RNAs and large DNA plasmids), viral delivery vectors and even engineered cell therapies require specific delivery designs distinct from traditional smaller molecule approaches on DES. While small molecules are currently the clinical standard for coronary stenting, extension of the DES to other lesion types, peripheral vasculature and non-vasculature therapies will seek to deliver an increasingly sophisticated armada of drug types. This review describes many of the larger molecule and biopharmaceutical approaches reported recently for stent-based delivery with the challenges associated with formulating and delivering these drug classes compared to the current small molecule drugs. It also includes perspectives on possible future applications that may improve safety and efficacy and facilitate diversification of the DES to other clinical applications. PMID:17929968

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

PubMed

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G+C-rich human DNA molecules, more likely results from a large-scale intrinsic curvature due to a persistent distribution of DNA curvature sites than from some increased flexibility.

An integrated optics microfluidic device for detecting single DNA molecules.

PubMed

Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W

2007-12-01

A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.

Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

PubMed

Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

2017-11-01

Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

Methods of DNA methylation detection

NASA Technical Reports Server (NTRS)

Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

2010-01-01

The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

A mathematical model for DNA

NASA Astrophysics Data System (ADS)

Sepehri, Alireza

Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

New Catalytic DNA Biosensors for Radionuclides and Metal ion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Lu

2008-03-01

We aim to develop new DNA biosensors for simultaneous detection and quantification of bioavailable radionuclides, such as uranium, technetium, and plutonium, and metal contaminants, such as lead, chromium, and mercury. The sensors will be highly sensitive and selective. They will be applied to on-site, real-time assessment of concentration, speciation, and stability of the individual contaminants before and during bioremediation, and for long-term monitoring of DOE contaminated sites. To achieve this goal, we have employed a combinatorial method called “in vitro selection” to search from a large DNA library (~ 1015 different molecules) for catalytic DNA molecules that are highly specificmore » for radionuclides or other metal ions through intricate 3-dimensional interactions as in metalloproteins. Comprehensive biochemical and biophysical studies have been performed on the selected DNA molecules. The findings from these studies have helped to elucidate fundamental principles for designing effective sensors for radionuclides and metal ions. Based on the study, the DNA have been converted to fluorescent or colorimetric sensors by attaching to it fluorescent donor/acceptor pairs or gold nanoparticles, with 11 part-per-trillion detection limit (for uranium) and over million fold selectivity (over other radionuclides and metal ions tested). Practical application of the biosensors for samples from the Environmental Remediation Sciences Program (ERSP) Field Research Center (FRC) at Oak Ridge has also been demonstrated.« less

Transportin mediates nuclear entry of DNA in vertebrate systems.

PubMed

Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael

2009-10-01

Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.

DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

PubMed

Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

2013-02-18

A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

Functional analysis of environmental DNA-derived type II polyketide synthases reveals structurally diverse secondary metabolites.

PubMed

Feng, Zhiyang; Kallifidas, Dimitris; Brady, Sean F

2011-08-02

A single gram of soil is predicted to contain thousands of unique bacterial species. The majority of these species remain recalcitrant to standard culture methods, prohibiting their use as sources of unique bioactive small molecules. The cloning and analysis of DNA extracted directly from environmental samples (environmental DNA, eDNA) provides a means of exploring the biosynthetic capacity of natural bacterial populations. Environmental DNA libraries contain large reservoirs of bacterial genetic diversity from which new secondary metabolite gene clusters can be systematically recovered and studied. The identification and heterologous expression of type II polyketide synthase-containing eDNA clones is reported here. Functional analysis of three soil DNA-derived polyketide synthase systems in Streptomyces albus revealed diverse metabolites belonging to well-known, rare, and previously uncharacterized structural families. The first of these systems is predicted to encode the production of the known antibiotic landomycin E. The second was found to encode the production of a metabolite with a previously uncharacterized pentacyclic ring system. The third was found to encode the production of unique KB-3346-5 derivatives, which show activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis. These results, together with those of other small-molecule-directed metagenomic studies, suggest that culture-independent approaches are capable of accessing biosynthetic diversity that has not yet been extensively explored using culture-based methods. The large-scale functional screening of eDNA clones should be a productive strategy for generating structurally previously uncharacterized chemical entities for use in future drug development efforts.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

PubMed

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target proteins and is likely to become a standard tool for pharmaceutical hit discovery, lead expansion, and Chemical Biology research. The introduction of new methodologies for library encoding and for compound synthesis in the presence of DNA is an exciting research field and will crucially contribute to the performance and the propagation of the technology.

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale

PubMed Central

Seeman, Nadrian C.; Lukeman, Philip S.

2012-01-01

DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542

Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

PubMed

Chen, Xiang

2013-09-01

A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Recognition Tunneling

PubMed Central

Lindsay, Stuart; He, Jin; Sankey, Otto; Hapala, Prokop; Jelinek, Pavel; Zhang, Peiming; Chang, Shuai; Huang, Shuo

2010-01-01

Single molecules in a tunnel junction can now be interrogated reliably using chemically-functionalized electrodes. Monitoring stochastic bonding fluctuations between a ligand bound to one electrode and its target bound to a second electrode (“tethered molecule-pair” configuration) gives insight into the nature of the intermolecular bonding at a single molecule-pair level, and defines the requirements for reproducible tunneling data. Simulations show that there is an instability in the tunnel gap at large currents, and this results in a multiplicity of contacts with a corresponding spread in the measured currents. At small currents (i.e. large gaps) the gap is stable, and functionalizing a pair of electrodes with recognition reagents (the “free analyte” configuration) can generate a distinct tunneling signal when an analyte molecule is trapped in the gap. This opens up a new interface between chemistry and electronics with immediate implications for rapid sequencing of single DNA molecules. PMID:20522930

Nanopore arrays in a silicon membrane for parallel single-molecule detection: fabrication

NASA Astrophysics Data System (ADS)

Schmidt, Torsten; Zhang, Miao; Sychugov, Ilya; Roxhed, Niclas; Linnros, Jan

2015-08-01

Solid state nanopores enable translocation and detection of single bio-molecules such as DNA in buffer solutions. Here, sub-10 nm nanopore arrays in silicon membranes were fabricated by using electron-beam lithography to define etch pits and by using a subsequent electrochemical etching step. This approach effectively decouples positioning of the pores and the control of their size, where the pore size essentially results from the anodizing current and time in the etching cell. Nanopores with diameters as small as 7 nm, fully penetrating 300 nm thick membranes, were obtained. The presented fabrication scheme to form large arrays of nanopores is attractive for parallel bio-molecule sensing and DNA sequencing using optical techniques. In particular the signal-to-noise ratio is improved compared to other alternatives such as nitride membranes suffering from a high-luminescence background.

Nanopore arrays in a silicon membrane for parallel single-molecule detection: fabrication.

PubMed

Schmidt, Torsten; Zhang, Miao; Sychugov, Ilya; Roxhed, Niclas; Linnros, Jan

2015-08-07

Solid state nanopores enable translocation and detection of single bio-molecules such as DNA in buffer solutions. Here, sub-10 nm nanopore arrays in silicon membranes were fabricated by using electron-beam lithography to define etch pits and by using a subsequent electrochemical etching step. This approach effectively decouples positioning of the pores and the control of their size, where the pore size essentially results from the anodizing current and time in the etching cell. Nanopores with diameters as small as 7 nm, fully penetrating 300 nm thick membranes, were obtained. The presented fabrication scheme to form large arrays of nanopores is attractive for parallel bio-molecule sensing and DNA sequencing using optical techniques. In particular the signal-to-noise ratio is improved compared to other alternatives such as nitride membranes suffering from a high-luminescence background.

A new cationic porphyrin derivative (TMPipEOPP) with large side arm substituents: a highly selective G-quadruplex optical probe.

PubMed

Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming

2012-01-01

The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.

High-resolution hydrodynamic chromatographic separation of large DNA using narrow, bare open capillaries: a rapid and economical alternative technology to pulsed-field gel electrophoresis?

PubMed

Liu, Lei; Veerappan, Vijaykumar; Pu, Qiaosheng; Cheng, Chang; Wang, Xiayan; Lu, Liping; Allen, Randy D; Guo, Guangsheng

2014-01-07

A high-resolution, rapid, and economical hydrodynamic chromatographic (HDC) method for large DNA separations in free solution was developed using narrow (5 μm diameter), bare open capillaries. Size-based separation was achieved in a chromatographic format with larger DNA molecules being eluting faster than smaller ones. Lambda DNA Mono Cut Mix was baseline-separated with the percentage resolutions generally less than 9.0% for all DNA fragments (1.5 to 48.5 kbp) tested in this work. High efficiencies were achieved for large DNA from this chromatographic technique, and the number of theoretical plates reached 3.6 × 10(5) plates for the longest (48.5 kbp) and 3.7 × 10(5) plates for the shortest (1.5 kbp) fragments. HDC parameters and performances were also discussed. The method was further applied for fractionating large DNA fragments from real-world samples (SacII digested Arabidopsis plant bacterial artificial chromosome (BAC) DNA and PmeI digested Rice BAC DNA) to demonstrate its feasibility for BAC DNA finger printing. Rapid separation of PmeI digested Rice BAC DNA covering from 0.44 to 119.041 kbp was achieved in less than 26 min. All DNA fragments of these samples were baseline separated in narrow bare open capillaries, while the smallest fragment (0.44 kbp) was missing in pulsed-field gel electrophoresis (PFGE) separation mode. It is demonstrated that narrow bare open capillary chromatography can realize a rapid separation for a wide size range of DNA mixtures that contain both small and large DNA fragments in a single run.

Dynamical Scaling and Phase Coexistence in Topologically Constrained DNA Melting.

PubMed

Fosado, Y A G; Michieletto, D; Marenduzzo, D

2017-09-15

There is a long-standing experimental observation that the melting of topologically constrained DNA, such as circular closed plasmids, is less abrupt than that of linear molecules. This finding points to an important role of topology in the physics of DNA denaturation, which is, however, poorly understood. Here, we shed light on this issue by combining large-scale Brownian dynamics simulations with an analytically solvable phenomenological Landau mean field theory. We find that the competition between melting and supercoiling leads to phase coexistence of denatured and intact phases at the single-molecule level. This coexistence occurs in a wide temperature range, thereby accounting for the broadening of the transition. Finally, our simulations show an intriguing topology-dependent scaling law governing the growth of denaturation bubbles in supercoiled plasmids, which can be understood within the proposed mean field theory.

The biology and polymer physics underlying large-scale chromosome organization.

PubMed

Sazer, Shelley; Schiessel, Helmut

2018-02-01

Chromosome large-scale organization is a beautiful example of the interplay between physics and biology. DNA molecules are polymers and thus belong to the class of molecules for which physicists have developed models and formulated testable hypotheses to understand their arrangement and dynamic properties in solution, based on the principles of polymer physics. Biologists documented and discovered the biochemical basis for the structure, function and dynamic spatial organization of chromosomes in cells. The underlying principles of chromosome organization have recently been revealed in unprecedented detail using high-resolution chromosome capture technology that can simultaneously detect chromosome contact sites throughout the genome. These independent lines of investigation have now converged on a model in which DNA loops, generated by the loop extrusion mechanism, are the basic organizational and functional units of the chromosome. © 2017 The Authors. Traffic published by John Wiley & Sons Ltd.

DNA-psoralen interaction: a single molecule experiment.

PubMed

Rocha, M S; Viana, N B; Mesquita, O N

2004-11-15

By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

DNA of a Human Hepatitis B Virus Candidate

PubMed Central

Robinson, William S.; Clayton, David A.; Greenman, Richard L.

1974-01-01

Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328

Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

PubMed Central

Kirkegaard, K; Nelsen, B

1990-01-01

Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

ERIC Educational Resources Information Center

Dimitrov, Valentin V.

2009-01-01

This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

PubMed

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

PubMed Central

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism

NASA Astrophysics Data System (ADS)

Jiang, Wen-Yan; Ran, Shi-Yong

2018-05-01

The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.

The unusual and dynamic character of PX-DNA

DOE PAGES

Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...

2015-07-15

PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less

Quantum kernel applications in medicinal chemistry.

PubMed

Huang, Lulu; Massa, Lou

2012-07-01

Progress in the quantum mechanics of biological molecules is being driven by computational advances. The notion of quantum kernels can be introduced to simplify the formalism of quantum mechanics, making it especially suitable for parallel computation of very large biological molecules. The essential idea is to mathematically break large biological molecules into smaller kernels that are calculationally tractable, and then to represent the full molecule by a summation over the kernels. The accuracy of the kernel energy method (KEM) is shown by systematic application to a great variety of molecular types found in biology. These include peptides, proteins, DNA and RNA. Examples are given that explore the KEM across a variety of chemical models, and to the outer limits of energy accuracy and molecular size. KEM represents an advance in quantum biology applicable to problems in medicine and drug design.

Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

PubMed Central

Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

2014-01-01

Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp–166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules. PMID:24918865

Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

NASA Astrophysics Data System (ADS)

Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

2014-06-01

Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp-166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules.

Visualization of yeast chromosomal DNA

NASA Technical Reports Server (NTRS)

Lubega, Seth

1990-01-01

The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.

Universal Readers Based on Hydrogen Bonding or π-π Stacking for Identification of DNA Nucleotides in Electron Tunnel Junctions.

PubMed

Biswas, Sovan; Sen, Suman; Im, JongOne; Biswas, Sudipta; Krstic, Predrag; Ashcroft, Brian; Borges, Chad; Zhao, Yanan; Lindsay, Stuart; Zhang, Peiming

2016-12-27

A reader molecule, which recognizes all the naturally occurring nucleobases in an electron tunnel junction, is required for sequencing DNA by a recognition tunneling (RT) technique, referred to as a universal reader. In the present study, we have designed a series of heterocyclic carboxamides based on hydrogen bonding and a large-sized pyrene ring based on a π-π stacking interaction as universal reader candidates. Each of these compounds was synthesized to bear a thiolated linker for attachment to metal electrodes and examined for their interactions with naturally occurring DNA nucleosides and nucleotides by 1 H NMR, ESI-MS, computational calculations, and surface plasmon resonance. RT measurements were carried out in a scanning tunnel microscope. All of these molecules generated electrical signals with DNA nucleotides in tunneling junctions under physiological conditions (phosphate buffered aqueous solution, pH 7.4). Using a support vector machine as a tool for data analysis, we found that these candidates distinguished among naturally occurring DNA nucleotides with the accuracy of pyrene (by π-π stacking interactions) > azole carboxamides (by hydrogen-bonding interactions). In addition, the pyrene reader operated efficiently in a larger tunnel junction. However, the azole carboxamide could read abasic (AP) monophosphate, a product from spontaneous base hydrolysis or an intermediate of base excision repair. Thus, we envision that sequencing DNA using both π-π stacking and hydrogen-bonding-based universal readers in parallel should generate more comprehensive genome sequences than sequencing based on either reader molecule alone.

The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-10-01

An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

PubMed Central

Eoff, Robert L.; Raney, Kevin D.

2010-01-01

Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

The mitochondrial genome of Hydra oligactis (Cnidaria, Hydrozoa) sheds new light on animal mtDNA evolution and cnidarian phylogeny.

PubMed

Kayal, Ehsan; Lavrov, Dennis V

2008-02-29

The 16,314-nuceotide sequence of the linear mitochondrial DNA (mtDNA) molecule of Hydra oligactis (Cnidaria, Hydrozoa)--the first from the class Hydrozoa--has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs, as is typical for cnidarians. All genes have the same transcriptional orientation and their arrangement in the genome is similar to that of the jellyfish Aurelia aurita. In addition, a partial copy of cox1 is present at one end of the molecule in a transcriptional orientation opposite to the rest of the genes, forming a part of inverted terminal repeat characteristic of linear mtDNA and linear mitochondrial plasmids. The sequence close to at least one end of the molecule contains several homonucleotide runs as well as small inverted repeats that are able to form strong secondary structures and may be involved in mtDNA maintenance and expression. Phylogenetic analysis of mitochondrial genes of H. oligactis and other cnidarians supports the Medusozoa hypothesis but also suggests that Anthozoa may be paraphyletic, with octocorallians more closely related to the Medusozoa than to the Hexacorallia. The latter inference implies that Anthozoa is paraphyletic and that the polyp (rather than a medusa) is the ancestral body type in Cnidaria.

Macroscopic modeling and simulations of supercoiled DNA with bound proteins

NASA Astrophysics Data System (ADS)

Huang, Jing; Schlick, Tamar

2002-11-01

General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Low frequency Raman study of the nucleosides

NASA Astrophysics Data System (ADS)

Koontz, Craig; Lee, Scott

2011-04-01

In both transcription and replication, the two helices of the DNA molecule move apart. Consequently, vibrations involving the relative motions of large portions of the molecule with respect to one another are of intrinsic interest. Such vibrations have relatively low frequencies because they involve weak bonds and large masses. Low frequency modes are difficult to observe in Raman spectroscopy because they are very close to the signal from the Rayleigh scattered light (which is very intense). In this poster, we will describe our results for the eight nucleosides: adenosine, deoxyadenosine, guanosine, deoxyguanosine, cytidine, deoxycytidine, uracil and deoxythymidine.

Low frequency Raman study of the nucleosides

NASA Astrophysics Data System (ADS)

Koontz, Craig; Lee, Scott

2011-03-01

In both transcription and replication, the two helices of the DNA molecule move apart. Consequently, vibrations involving the relative motions of large portions of the molecule with respect to one another are of intrinsic interest. Such vibrations have relatively low frequencies because they involve weak bonds and large masses. Low frequency modes are difficult to observe in Raman spectroscopy because they are very close to the signal from the Rayleigh scattered light (which is very intense). In this poster, we will describe our results for the eight nucleosides: adenosine, deoxyadenosine, guanosine, deoxyguanosine, cytidine, deoxycytidine, uracil and deoxythymidine.

Low frequency Raman study of the nucleosides

NASA Astrophysics Data System (ADS)

Koontz, Craig; Lee, Scott

2010-10-01

In both transcription and replication, the two helices of the DNA molecule move apart. Consequently, vibrations involving the relative motions of large portions of the molecule with respect to one another are of intrinsic interest. Such vibrations have relatively low frequencies because they involve weak bonds and large masses. Low frequency modes are difficult to observe in Raman spectroscopy because they are very close to the signal from the Rayleigh scattered light (which is very intense). In this poster, we will describe our results for the eight nucleosides: adenosine, deoxyadenosine, guanosine, deoxyguanosine, cytidine, deoxycytidine, uracil and deoxythymidine.

Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

ERIC Educational Resources Information Center

Ito, Takashi

2008-01-01

This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

PubMed

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the motions of the minicircle as a whole from knowledge of the full set of normal modes. The remarkable agreement between computed and theoretically predicted values of the average deviation and dispersion of the writhe of the circular configuration adds to the reliability in the computational approach. Application of the new formalism to the computed modes of the figure-8 provides insights into macromolecular motions which are beyond the scope of current theoretical treatments.

Blueprints for green biotech: development and application of standards for plant synthetic biology.

PubMed

Patron, Nicola J

2016-06-15

Synthetic biology aims to apply engineering principles to the design and modification of biological systems and to the construction of biological parts and devices. The ability to programme cells by providing new instructions written in DNA is a foundational technology of the field. Large-scale de novo DNA synthesis has accelerated synthetic biology by offering custom-made molecules at ever decreasing costs. However, for large fragments and for experiments in which libraries of DNA sequences are assembled in different combinations, assembly in the laboratory is still desirable. Biological assembly standards allow DNA parts, even those from multiple laboratories and experiments, to be assembled together using the same reagents and protocols. The adoption of such standards for plant synthetic biology has been cohesive for the plant science community, facilitating the application of genome editing technologies to plant systems and streamlining progress in large-scale, multi-laboratory bioengineering projects. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

Optical mapping and its potential for large-scale sequencing projects.

PubMed

Aston, C; Mishra, B; Schwartz, D C

1999-07-01

Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.

Discovery of DNA repair inhibitors by combinatorial library profiling

PubMed Central

Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih

2011-01-01

Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400

Combining crystallography and EPR: crystal and solution structures of the multidomain cochaperone DnaJ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de; Brosi, Richard W. W.; Steinmetz, Andrea

2013-08-01

The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein,more » but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.« less

Visualization of DNA molecules in time during electrophoresis

NASA Technical Reports Server (NTRS)

Lubega, Seth

1991-01-01

For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

NASA Astrophysics Data System (ADS)

Kowalczykowski, Stephen

2013-03-01

We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

Micronuclear DNA of Oxytricha nova contains sequences with autonomously replicating activity in Saccharomyces cerevisiae.

PubMed Central

Colombo, M M; Swanton, M T; Donini, P; Prescott, D M

1984-01-01

Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934

Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

PubMed

Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

2011-02-09

Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

Chemical Topic Modeling: Exploring Molecular Data Sets Using a Common Text-Mining Approach.

PubMed

Schneider, Nadine; Fechner, Nikolas; Landrum, Gregory A; Stiefl, Nikolaus

2017-08-28

Big data is one of the key transformative factors which increasingly influences all aspects of modern life. Although this transformation brings vast opportunities it also generates novel challenges, not the least of which is organizing and searching this data deluge. The field of medicinal chemistry is not different: more and more data are being generated, for instance, by technologies such as DNA encoded libraries, peptide libraries, text mining of large literature corpora, and new in silico enumeration methods. Handling those huge sets of molecules effectively is quite challenging and requires compromises that often come at the expense of the interpretability of the results. In order to find an intuitive and meaningful approach to organizing large molecular data sets, we adopted a probabilistic framework called "topic modeling" from the text-mining field. Here we present the first chemistry-related implementation of this method, which allows large molecule sets to be assigned to "chemical topics" and investigating the relationships between those. In this first study, we thoroughly evaluate this novel method in different experiments and discuss both its disadvantages and advantages. We show very promising results in reproducing human-assigned concepts using the approach to identify and retrieve chemical series from sets of molecules. We have also created an intuitive visualization of the chemical topics output by the algorithm. This is a huge benefit compared to other unsupervised machine-learning methods, like clustering, which are commonly used to group sets of molecules. Finally, we applied the new method to the 1.6 million molecules of the ChEMBL22 data set to test its robustness and efficiency. In about 1 h we built a 100-topic model of this large data set in which we could identify interesting topics like "proteins", "DNA", or "steroids". Along with this publication we provide our data sets and an open-source implementation of the new method (CheTo) which will be part of an upcoming version of the open-source cheminformatics toolkit RDKit.

Image processing for optical mapping.

PubMed

Ravindran, Prabu; Gupta, Aditya

2015-01-01

Optical Mapping is an established single-molecule, whole-genome analysis system, which has been used to gain a comprehensive understanding of genomic structure and to study structural variation of complex genomes. A critical component of Optical Mapping system is the image processing module, which extracts single molecule restriction maps from image datasets of immobilized, restriction digested and fluorescently stained large DNA molecules. In this review, we describe robust and efficient image processing techniques to process these massive datasets and extract accurate restriction maps in the presence of noise, ambiguity and confounding artifacts. We also highlight a few applications of the Optical Mapping system.

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

PubMed

Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

2016-05-01

The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

Right-handed double-helix ultrashort DNA yields chiral nematic phases with both right- and left-handed director twist

PubMed Central

Zanchetta, Giuliano; Giavazzi, Fabio; Nakata, Michi; Buscaglia, Marco; Cerbino, Roberto; Clark, Noel A.; Bellini, Tommaso

2010-01-01

Concentrated solutions of duplex-forming DNA oligomers organize into various mesophases among which is the nematic (N∗), which exhibits a macroscopic chiral helical precession of molecular orientation because of the chirality of the DNA molecule. Using a quantitative analysis of the transmission spectra in polarized optical microscopy, we have determined the handedness and pitch of this chiral nematic helix for a large number of sequences ranging from 8 to 20 bases. The B-DNA molecule exhibits a right-handed molecular double-helix structure that, for long molecules, always yields N∗ phases with left-handed pitch in the μm range. We report here that ultrashort oligomeric duplexes show an extremely diverse behavior, with both left- and right-handed N∗ helices and pitches ranging from macroscopic down to 0.3 μm. The behavior depends on the length and the sequence of the oligomers, and on the nature of the end-to-end interactions between helices. In particular, the N∗ handedness strongly correlates with the oligomer length and concentration. Right-handed phases are found only for oligomers shorter than 14 base pairs, and for the sequences having the transition to the N∗ phase at concentration larger than 620 mg/mL. Our findings indicate that in short DNA, the intermolecular double-helical interactions switch the preferred liquid crystal handedness when the columns of stacked duplexes are forced at high concentrations to separations comparable to the DNA double-helix pitch, a regime still to be theoretically described. PMID:20876125

DNA-Based Single-Molecule Electronics: From Concept to Function.

PubMed

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

DNA-Based Single-Molecule Electronics: From Concept to Function

PubMed Central

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

Logic Gate Operation by DNA Translocation through Biological Nanopores.

PubMed

Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

Logic Gate Operation by DNA Translocation through Biological Nanopores

PubMed Central

Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568

Mitochondrial targeting of recombinant RNAs modulates the level of a heteroplasmic mutation in human mitochondrial DNA associated with Kearns Sayre Syndrome

PubMed Central

Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

2013-01-01

Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375

An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

PubMed Central

Stark, Martha R.; Pleiss, Jeffrey A.; Deras, Michael; Scaringe, Stephen A.; Rader, Stephen D.

2006-01-01

RNA ligation has been a powerful tool for incorporation of cross-linkers and nonnatural nucleotides into internal positions of RNA molecules. The most widely used method for template-directed RNA ligation uses DNA ligase and a DNA splint. While this method has been used successfully for many years, it suffers from a number of drawbacks, principally, slow and inefficient product formation and slow product release, resulting in a requirement for large quantities of enzyme. We describe an alternative technique catalyzed by T4 RNA ligase instead of DNA ligase. Using a splint design that allows the ligation junction to mimic the natural substrate of RNA ligase, we demonstrate several ligation reactions that appear to go nearly to completion. Furthermore, the reactions generally go to completion within 30 min. We present data evaluating the relative importance of various parameters in this reaction. Finally, we show the utility of this method by generating a 128-nucleotide pre-mRNA from three synthetic oligoribonucleotides. The ability to ligate synthetic or in vitro transcribed RNA with high efficiency has the potential to open up areas of RNA biology to new functional and biophysical investigation. In particular, we anticipate that site-specific incorporation of fluorescent dyes into large RNA molecules will yield a wealth of new information on RNA structure and function. PMID:16983143

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

NASA Astrophysics Data System (ADS)

Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

2016-07-01

The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

Nanopore detection of DNA molecules in crowded neutral polymer solutions

NASA Astrophysics Data System (ADS)

Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven

Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.

Single molecule techniques in DNA repair: A primer

PubMed Central

Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.

2016-01-01

A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596

Exercises in molecular computing.

PubMed

Stojanovic, Milan N; Stefanovic, Darko; Rudchenko, Sergei

2014-06-17

CONSPECTUS: The successes of electronic digital logic have transformed every aspect of human life over the last half-century. The word "computer" now signifies a ubiquitous electronic device, rather than a human occupation. Yet evidently humans, large assemblies of molecules, can compute, and it has been a thrilling challenge to develop smaller, simpler, synthetic assemblies of molecules that can do useful computation. When we say that molecules compute, what we usually mean is that such molecules respond to certain inputs, for example, the presence or absence of other molecules, in a precisely defined but potentially complex fashion. The simplest way for a chemist to think about computing molecules is as sensors that can integrate the presence or absence of multiple analytes into a change in a single reporting property. Here we review several forms of molecular computing developed in our laboratories. When we began our work, combinatorial approaches to using DNA for computing were used to search for solutions to constraint satisfaction problems. We chose to work instead on logic circuits, building bottom-up from units based on catalytic nucleic acids, focusing on DNA secondary structures in the design of individual circuit elements, and reserving the combinatorial opportunities of DNA for the representation of multiple signals propagating in a large circuit. Such circuit design directly corresponds to the intuition about sensors transforming the detection of analytes into reporting properties. While this approach was unusual at the time, it has been adopted since by other groups working on biomolecular computing with different nucleic acid chemistries. We created logic gates by modularly combining deoxyribozymes (DNA-based enzymes cleaving or combining other oligonucleotides), in the role of reporting elements, with stem-loops as input detection elements. For instance, a deoxyribozyme that normally exhibits an oligonucleotide substrate recognition region is modified such that a stem-loop closes onto the substrate recognition region, making it unavailable for the substrate and thus rendering the deoxyribozyme inactive. But a conformational change can then be induced by an input oligonucleotide, complementary to the loop, to open the stem, allow the substrate to bind, and allow its cleavage to proceed, which is eventually reported via fluorescence. In this Account, several designs of this form are reviewed, along with their application in the construction of large circuits that exhibited complex logical and temporal relationships between the inputs and the outputs. Intelligent (in the sense of being capable of nontrivial information processing) theranostic (therapy + diagnostic) applications have always been the ultimate motivation for developing computing (i.e., decision-making) circuits, and we review our experiments with logic-gate elements bound to cell surfaces that evaluate the proximal presence of multiple markers on lymphocytes.

Exercises in Molecular Computing

PubMed Central

2014-01-01

Conspectus The successes of electronic digital logic have transformed every aspect of human life over the last half-century. The word “computer” now signifies a ubiquitous electronic device, rather than a human occupation. Yet evidently humans, large assemblies of molecules, can compute, and it has been a thrilling challenge to develop smaller, simpler, synthetic assemblies of molecules that can do useful computation. When we say that molecules compute, what we usually mean is that such molecules respond to certain inputs, for example, the presence or absence of other molecules, in a precisely defined but potentially complex fashion. The simplest way for a chemist to think about computing molecules is as sensors that can integrate the presence or absence of multiple analytes into a change in a single reporting property. Here we review several forms of molecular computing developed in our laboratories. When we began our work, combinatorial approaches to using DNA for computing were used to search for solutions to constraint satisfaction problems. We chose to work instead on logic circuits, building bottom-up from units based on catalytic nucleic acids, focusing on DNA secondary structures in the design of individual circuit elements, and reserving the combinatorial opportunities of DNA for the representation of multiple signals propagating in a large circuit. Such circuit design directly corresponds to the intuition about sensors transforming the detection of analytes into reporting properties. While this approach was unusual at the time, it has been adopted since by other groups working on biomolecular computing with different nucleic acid chemistries. We created logic gates by modularly combining deoxyribozymes (DNA-based enzymes cleaving or combining other oligonucleotides), in the role of reporting elements, with stem–loops as input detection elements. For instance, a deoxyribozyme that normally exhibits an oligonucleotide substrate recognition region is modified such that a stem–loop closes onto the substrate recognition region, making it unavailable for the substrate and thus rendering the deoxyribozyme inactive. But a conformational change can then be induced by an input oligonucleotide, complementary to the loop, to open the stem, allow the substrate to bind, and allow its cleavage to proceed, which is eventually reported via fluorescence. In this Account, several designs of this form are reviewed, along with their application in the construction of large circuits that exhibited complex logical and temporal relationships between the inputs and the outputs. Intelligent (in the sense of being capable of nontrivial information processing) theranostic (therapy + diagnostic) applications have always been the ultimate motivation for developing computing (i.e., decision-making) circuits, and we review our experiments with logic-gate elements bound to cell surfaces that evaluate the proximal presence of multiple markers on lymphocytes. PMID:24873234

DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

PubMed Central

Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

2016-01-01

DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

Structure-Based Virtual Ligand Screening on the XRCC4/DNA Ligase IV Interface

NASA Astrophysics Data System (ADS)

Menchon, Grégory; Bombarde, Oriane; Trivedi, Mansi; Négrel, Aurélie; Inard, Cyril; Giudetti, Brigitte; Baltas, Michel; Milon, Alain; Modesti, Mauro; Czaplicki, Georges; Calsou, Patrick

2016-03-01

The association of DNA Ligase IV (Lig4) with XRCC4 is essential for repair of DNA double-strand breaks (DSBs) by Non-homologous end-joining (NHEJ) in humans. DSBs cytotoxicity is largely exploited in anticancer therapy. Thus, NHEJ is an attractive target for strategies aimed at increasing the sensitivity of tumors to clastogenic anticancer treatments. However the high affinity of the XRCC4/Lig4 interaction and the extended protein-protein interface make drug screening on this target particularly challenging. Here, we conducted a pioneering study aimed at interfering with XRCC4/Lig4 assembly. By Molecular Dynamics simulation using the crystal structure of the complex, we first delineated the Lig4 clamp domain as a limited suitable target. Then, we performed in silico screening of ~95,000 filtered molecules on this Lig4 subdomain. Hits were evaluated by Differential Scanning Fluorimetry, Saturation Transfer Difference - NMR spectroscopy and interaction assays with purified recombinant proteins. In this way we identified the first molecule able to prevent Lig4 binding to XRCC4 in vitro. This compound has a unique tripartite interaction with the Lig4 clamp domain that suggests a starting chemotype for rational design of analogous molecules with improved affinity.

The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

PubMed

Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

2018-01-09

Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Biomolecular computers with multiple restriction enzymes.

PubMed

Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

2017-01-01

The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann "bottleneck". Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro's group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.

Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

NASA Astrophysics Data System (ADS)

Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

2017-05-01

We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

Fluorescence Microscopy of Nanochannel-Confined DNA.

PubMed

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Genetics Home Reference: mitochondrial neurogastrointestinal encephalopathy disease

MedlinePlus

... modification) is used as a building block of DNA . Thymidine phosphorylase breaks down thymidine into smaller molecules, ... molecule is damaging to a particular kind of DNA known as mitochondrial DNA or mtDNA. Mitochondria are ...

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

DNA recombination activity in soybean mitochondria.

PubMed

Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

2006-02-17

Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

1994-01-01

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

Spermine Condenses DNA, but Not RNA Duplexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.

Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less

Functional helicoidal model of DNA molecule with elastic nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2013-06-01

We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

NASA Astrophysics Data System (ADS)

Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

2015-04-01

Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

Single-Molecule Electrical Random Resequencing of DNA and RNA

NASA Astrophysics Data System (ADS)

Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

2012-07-01

Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

Identifying DNA methylation in a nanochannel

NASA Astrophysics Data System (ADS)

Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu

2016-01-01

DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

1994-10-18

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Agarose gel electrophoresis for the separation of DNA fragments.

PubMed

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

PubMed

Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-31

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

PubMed Central

Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-01

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

Extraction of nucleic acids from yeast cells and plant tissues using ethanol as medium for sample preservation and cell disruption.

PubMed

Linke, Bettina; Schröder, Kersten; Arter, Juliane; Gasperazzo, Tatiana; Woehlecke, Holger; Ehwald, Rudolf

2010-09-01

Here we report that dehydrated ethanol is an excellent medium for both in situ preservation of nucleic acids and cell disruption of plant and yeast cells. Cell disruption was strongly facilitated by prior dehydration of the ethanol using dehydrated zeolite. Following removal of ethanol, nucleic acids were extracted from the homogenate pellet using denaturing buffers. The method provided DNA and RNA of high yield and integrity. Whereas cell wall disruption was essential for extraction of DNA and large RNA molecules, smaller molecules such as tRNAs could be selectively extracted from undisrupted, ethanol-treated yeast cells. Our results demonstrate the utility of absolute ethanol for sample fixation, cell membrane and cell wall disruption, as well as preservation of nucleic acids during sample storage.

Drug-DNA interactions at single molecule level: A view with optical tweezers

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan

Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

PubMed Central

Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

2011-01-01

The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

A smart magnetic resonance imaging contrast agent responsive to adenosine based on a DNA aptamer-conjugated gadolinium complex.

PubMed

Xu, Weichen; Lu, Yi

2011-05-07

We report a general strategy for developing a smart MRI contrast agent for the sensing of small molecules such as adenosine based on a DNA aptamer that is conjugated to a Gd compound and a protein streptavidin. The binding of adenosine to its aptamer results in the dissociation of the Gd compound from the large protein, leading to decreases in the rotational correlation time and thus change of MRI contrast. © The Royal Society of Chemistry 2011

Assembly of Colloidal Materials Using Bioadhesive Interactions

NASA Technical Reports Server (NTRS)

Hammer, Daniel A.; Hiddessen, Amy L.; Tohver, Valeria; Crocker, John C.; Weitz, David A.

2002-01-01

We have pursued the use of biological crosslinking molecules of several types to make colloidal materials at relatively low volume fraction of colloidal particles. The objective is to make binary alloys of colloidal particles, made of two different colloidal particles coated with complementary biological lock-and-key binding molecules, which assemble due to the biological specificity. The long-term goal is to use low affinity lock-and-key biological interactions, so that the can anneal to form crystalline states. We have used a variety of different surface chemistries in order to make colloidal materials. Our first system involved using selectin-carbohydrate (sialyl-Lewis) interactions; this chemistry is derived from immune system. This chemical interaction is of relatively low affinity, with timescales for dissociation of several seconds. Furthermore, the adhesion mediated by these molecules can be reversed by the chelation of calcium atoms; thus assembled structures can be disassembled reversibly. Our second system employed avidin-biotin chemistry. This well-studied system is of high affinity, and is generally irreversible on a laboratory time-scale. Thus, we would expect selectin-carbohydrate interactions at high molecular density and avidin-biotin interactions to give kinetically-trapped structures; however, at low densities, we would expect significant differences in the structure and dynamics of the two materials, owing to their very different release rates. We have also begun to use a third chemistry - DNA hybridization. By attaching single stranded DNA oligonucleotide chains to beads, we can drive the assembly of colloidal materials by hybridization of complementary DNA chains. It is well known that DNA adenosine-thymine (A-T) and guanine-cytosine (G-C) bases hybridize pairwise with a Gibbs free energy change of 1.7 kcal/mol per base; thus, the energy of the assembly can be modulated by altering the number of complementary bases in the DNA chains. Using these different crosslinking molecules, we have assembled colloidal materials from different-sized colloidal particles, A and B. In the first sets of experiment, we used high densities of adhesion molecules, and 0.96 micron (A) and 5.5 micron (B) diameter particles. The high density of adhesion molecules means that the structures are kinetically trapped in nonequilibrium configurations. The structure of the suspension can be varied by changing the number ratio of the two types of colloidal particles, NA and NB, where A is the smaller particle. With carbohydrate-selectin or avidin-biotin interactions, large NA/NB leads to the formation of colloidal micelles, with the large center B particle surrounded by many smaller A particles. As the ratio NA/NB decreases, the structures become more extended, approaching the formation of macro-Rouse polymers - extended linear chains where A beads are connected with intervening small B linkers.

Detecting the Length of Double-stranded DNA with Solid State Nanopores

NASA Astrophysics Data System (ADS)

Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

2003-03-01

We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

NASA Astrophysics Data System (ADS)

Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

2008-06-01

Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

PubMed

Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

2017-09-01

Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

PubMed

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes.

PubMed

Fredlake, Christopher P; Hert, Daniel G; Kan, Cheuk-Wai; Chiesl, Thomas N; Root, Brian E; Forster, Ryan E; Barron, Annelise E

2008-01-15

To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require approximately 70 min to deliver approximately 650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered "hybrid" mechanism of DNA electromigration, in which DNA molecules alternate rapidly between repeating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs.

Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes

PubMed Central

Fredlake, Christopher P.; Hert, Daniel G.; Kan, Cheuk-Wai; Chiesl, Thomas N.; Root, Brian E.; Forster, Ryan E.; Barron, Annelise E.

2008-01-01

To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require ≈70 min to deliver ≈650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered “hybrid” mechanism of DNA electromigration, in which DNA molecules alternate rapidly between reptating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs. PMID:18184818

Binding and thermodynamics of REV peptide-ctDNA interaction.

PubMed

Upadhyay, Santosh Kumar

2017-03-01

The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

Using Protein Dimers to Maximize the Protein Hybridization Efficiency with Multisite DNA Origami Scaffolds

PubMed Central

Verma, Vikash; Mallik, Leena; Hariadi, Rizal F.; Sivaramakrishnan, Sivaraj; Skiniotis, Georgios; Joglekar, Ajit P.

2015-01-01

DNA origami provides a versatile platform for conducting ‘architecture-function’ analysis to determine how the nanoscale organization of multiple copies of a protein component within a multi-protein machine affects its overall function. Such analysis requires that the copy number of protein molecules bound to the origami scaffold exactly matches the desired number, and that it is uniform over an entire scaffold population. This requirement is challenging to satisfy for origami scaffolds with many protein hybridization sites, because it requires the successful completion of multiple, independent hybridization reactions. Here, we show that a cleavable dimerization domain on the hybridizing protein can be used to multiplex hybridization reactions on an origami scaffold. This strategy yields nearly 100% hybridization efficiency on a 6-site scaffold even when using low protein concentration and short incubation time. It can also be developed further to enable reliable patterning of a large number of molecules on DNA origami for architecture-function analysis. PMID:26348722

Messenger RNA transcripts

Treesearch

Dan Cullen

2004-01-01

In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...

Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

PubMed Central

Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

2003-01-01

Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

PubMed Central

Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

2014-01-01

Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Disentangling DNA molecules

NASA Astrophysics Data System (ADS)

Vologodskii, Alexander

2016-09-01

The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

PubMed Central

Hong, Ka Lok

2015-01-01

Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Irc3 is a mitochondrial DNA branch migration enzyme

PubMed Central

Gaidutšik, Ilja; Sedman, Tiina; Sillamaa, Sirelin; Sedman, Juhan

2016-01-01

Integrity of mitochondrial DNA (mtDNA) is essential for cellular energy metabolism. In the budding yeast Saccharomyces cerevisiae, a large number of nuclear genes influence the stability of mitochondrial genome; however, most corresponding gene products act indirectly and the actual molecular mechanisms of mtDNA inheritance remain poorly characterized. Recently, we found that a Superfamily II helicase Irc3 is required for the maintenance of mitochondrial genome integrity. Here we show that Irc3 is a mitochondrial DNA branch migration enzyme. Irc3 modulates mtDNA metabolic intermediates by preferential binding and unwinding Holliday junctions and replication fork structures. Furthermore, we demonstrate that the loss of Irc3 can be complemented with mitochondrially targeted RecG of Escherichia coli. We suggest that Irc3 could support the stability of mtDNA by stimulating fork regression and branch migration or by inhibiting the formation of irregular branched molecules. PMID:27194389

Polymorphism of DNA conformation inside the bacteriophage capsid.

PubMed

Leforestier, Amélie

2013-03-01

Double-stranded DNA bacteriophage genomes are packaged into their icosahedral capsids at the highest densities known so far (about 50 % w:v). How the molecule is folded at such density and how its conformation changes upon ejection or packaging are fascinating questions still largely open. We review cryo-TEM analyses of DNA conformation inside partially filled capsids as a function of the physico-chemical environment (ions, osmotic pressure, temperature). We show that there exists a wide variety of DNA conformations. Strikingly, the different observed structures can be described by some of the different models proposed over the years for DNA organisation inside bacteriophage capsids: either spool-like structures with axial or concentric symmetries, or liquid crystalline structures characterised by a DNA homogeneous density. The relevance of these conformations for the understanding of DNA folding and unfolding upon ejection and packaging in vivo is discussed.

Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haab, B.B.; Mathies, R.A.

A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

In vitro-reconstituted nucleoids can block mitochondrial DNA replication and transcription.

PubMed

Farge, Géraldine; Mehmedovic, Majda; Baclayon, Marian; van den Wildenberg, Siet M J L; Roos, Wouter H; Gustafsson, Claes M; Wuite, Gijs J L; Falkenberg, Maria

2014-07-10

The mechanisms regulating the number of active copies of mtDNA are still unclear. A mammalian cell typically contains 1,000-10,000 copies of mtDNA, which are packaged into nucleoprotein complexes termed nucleoids. The main protein component of these structures is mitochondrial transcription factor A (TFAM). Here, we reconstitute nucleoid-like particles in vitro and demonstrate that small changes in TFAM levels dramatically impact the fraction of DNA molecules available for transcription and DNA replication. Compaction by TFAM is highly cooperative, and at physiological ratios of TFAM to DNA, there are large variations in compaction, from fully compacted nucleoids to naked DNA. In compacted nucleoids, TFAM forms stable protein filaments on DNA that block melting and prevent progression of the replication and transcription machineries. Based on our observations, we suggest that small variations in the TFAM-to-mtDNA ratio may be used to regulate mitochondrial gene transcription and DNA replication. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions.

PubMed

Brown, Maxwell W; Kim, Yoori; Williams, Gregory M; Huck, John D; Surtees, Jennifer A; Finkelstein, Ilya J

2016-02-03

DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2-Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2-Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2-Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2-Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2-Msh3 and Msh2-Msh6 navigate on a crowded genome and suggest how Msh2-Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin.

Winding single-molecule double-stranded DNA on a nanometer-sized reel

PubMed Central

You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

2012-01-01

A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

Charge Structure and Counterion Distribution in Hexagonal DNA Liquid Crystal

PubMed Central

Dai, Liang; Mu, Yuguang; Nordenskiöld, Lars; Lapp, Alain; van der Maarel, Johan R. C.

2007-01-01

A hexagonal liquid crystal of DNA fragments (double-stranded, 150 basepairs) with tetramethylammonium (TMA) counterions was investigated with small angle neutron scattering (SANS). We obtained the structure factors pertaining to the DNA and counterion density correlations with contrast matching in the water. Molecular dynamics (MD) computer simulation of a hexagonal assembly of nine DNA molecules showed that the inter-DNA distance fluctuates with a correlation time around 2 ns and a standard deviation of 8.5% of the interaxial spacing. The MD simulation also showed a minimal effect of the fluctuations in inter-DNA distance on the radial counterion density profile and significant penetration of the grooves by TMA. The radial density profile of the counterions was also obtained from a Monte Carlo (MC) computer simulation of a hexagonal array of charged rods with fixed interaxial spacing. Strong ordering of the counterions between the DNA molecules and the absence of charge fluctuations at longer wavelengths was shown by the SANS number and charge structure factors. The DNA-counterion and counterion structure factors are interpreted with the correlation functions derived from the Poisson-Boltzmann equation, MD, and MC simulation. Best agreement is observed between the experimental structure factors and the prediction based on the Poisson-Boltzmann equation and/or MC simulation. The SANS results show that TMA is too large to penetrate the grooves to a significant extent, in contrast to what is shown by MD simulation. PMID:17098791

Sub-Terrahertz Spectroscopy of E.COLI Dna: Experiment, Statistical Model, and MD Simulations

NASA Astrophysics Data System (ADS)

Sizov, I.; Dorofeeva, T.; Khromova, T.; Gelmont, B.; Globus, T.

2012-06-01

We will present result of combined experimental and computational study of sub-THz absorption spectra from Escherichia coli (E.coli) DNA. Measurements were conducted using a Bruker FTIR spectrometer with a liquid helium cooled bolometer and a recently developed frequency domain sensor operating at room temperature, with spectral resolution of 0.25 cm-1 and 0.03 cm-1, correspondingly. We have earlier demonstrated that molecular dynamics (MD) simulation can be effectively applied for characterizing relatively small biological molecules, such as transfer RNA or small protein thioredoxin from E. coli , and help to understand and predict their absorption spectra. Large size of DNA macromolecules ( 5 million base pairs for E. coli DNA) prevents, however, direct application of MD simulation at the current level of computational capabilities. Therefore, by applying a second order Markov chain approach and Monte-Carlo technique, we have developed a new statistical model to construct DNA sequences from biological cells. These short representative sequences (20-60 base pairs) are built upon the most frequently repeated fragments (2-10 base pairs) in the original DNA. Using this new approach, we constructed DNA sequences for several non-pathogenic strains of E.coli, including a well-known strain BL21, uro-pathogenic strain, CFT073, and deadly EDL933 strain (O157:H7), and used MD simulations to calculate vibrational absorption spectra of these strains. Significant differences are clearly present in spectra of strains in averaged spectra and in all components for particular orientations. The mechanism of interaction of THz radiation with a biological molecule is studied by analyzing dynamics of atoms and correlation of local vibrations in the modeled molecule. Simulated THz vibrational spectra of DNA are compared with experimental results. With the spectral resolution of 0.1 cm-1 or better, which is now available in experiments, the very easy discrimination between different strains of the same bacteria becomes possible.

High-throughput DNA separation in nanofilter arrays.

PubMed

Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong

2014-08-01

We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

PubMed Central

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

DNA mechanics as a tool to probe helicase and translocase activity.

PubMed

Lionnet, Timothée; Dawid, Alexandre; Bigot, Sarah; Barre, François-Xavier; Saleh, Omar A; Heslot, François; Allemand, Jean-François; Bensimon, David; Croquette, Vincent

2006-01-01

Helicases and translocases are proteins that use the energy derived from ATP hydrolysis to move along or pump nucleic acid substrates. Single molecule manipulation has proved to be a powerful tool to investigate the mechanochemistry of these motors. Here we first describe the basic mechanical properties of DNA unraveled by single molecule manipulation techniques. Then we demonstrate how the knowledge of these properties has been used to design single molecule assays to address the enzymatic mechanisms of different translocases. We report on four single molecule manipulation systems addressing the mechanism of different helicases using specifically designed DNA substrates: UvrD enzyme activity detection on a stretched nicked DNA molecule, HCV NS3 helicase unwinding of a RNA hairpin under tension, the observation of RecBCD helicase/nuclease forward and backward motion, and T7 gp4 helicase mediated opening of a synthetic DNA replication fork. We then discuss experiments on two dsDNA translocases: the RuvAB motor studied on its natural substrate, the Holliday junction, and the chromosome-segregation motor FtsK, showing its unusual coupling to DNA supercoiling.

Enhancement of the thermoelectric figure of merit in DNA-like systems induced by Fano and Dicke effects.

PubMed

Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan

2015-04-28

We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

PubMed

Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

2012-01-01

In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules

NASA Astrophysics Data System (ADS)

Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna

2017-12-01

Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.

Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

NASA Astrophysics Data System (ADS)

Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

1997-11-01

We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

PubMed

Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

2018-06-13

The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

Development of novel vaccines using DNA shuffling and screening strategies.

PubMed

Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

2004-02-01

DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

NASA Technical Reports Server (NTRS)

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

DNA confinement in nanochannels: physics and biological applications

NASA Astrophysics Data System (ADS)

Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

DNA confinement in nanochannels: physics and biological applications.

PubMed

Reisner, Walter; Pedersen, Jonas N; Austin, Robert H

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

Current-voltage characteristics of double stranded versus single stranded DNA molecules

NASA Astrophysics Data System (ADS)

Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

2004-03-01

Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

Synthesis, DNA binding and cytotoxic activity of pyrimido[4',5':4,5]thieno(2,3-b)quinoline with 9-hydroxy-4-(3-diethylaminopropylamino) and 8-methoxy-4-(3-diethylaminopropylamino) substitutions.

PubMed

KiranKumar, Hulihalli N; RohitKumar, Heggodu G; Advirao, Gopal M

2018-01-01

Two new derivatives of pyrimido[4',5';4,5]thieno(2,3-b)quinoline (PTQ), 9-hydroxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Hydroxy-DPTQ) and 8-methoxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Methoxy-DPTQ) were synthesized and their DNA binding ability was analyzed using spectroscopy (UV-visible, fluorescence and circular dichroism), ethidium bromide dye displacement assay, melting temperature (T m ) analysis and computational docking studies. The hypochromism in UV-visible spectrum and increased fluorescence emission of Hydroxy-DPTQ and Methoxy-DPTQ in the presence of DNA suggested the molecule-DNA interaction. The association constants calculated from UV-visible and spectral titrations were of the order 10 4 to 10 6 M -1 . Circular dichroism studies corroborated the induced conformational changes in DNA upon addition of molecules. The change in the ellipticity was observed both in negative and positive peak of DNA, thus, suggesting the intercalation of molecules. The observed displacement of ethidium bromide from the DNA and increased T m , upon addition of DNA confirmed the intercalative mode of binding. This was further validated by computational docking, which showed clear intercalation of molecules into the d(GpC)-d(CpG) site of the receptor DNA. Anticancer activities of these molecules are evaluated by using MTT assay. Both molecules showed antiproliferative activity against all the three cancer cells studied, with Hydroxy-DPTQ being more potential molecule among the two. IC 50 value of Hydroxy-DPTQ and Methoxy-DPTQ were in the range of 3-5μM and 130-250μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Crystal Structures of SlyA Protein, a Master Virulence Regulator of Salmonella, in Free and DNA-bound States

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dolan, Kyle T.; Duguid, Erica M.; He, Chuan

2011-11-17

SlyA is a master virulence regulator that controls the transcription of numerous genes in Salmonella enterica. We present here crystal structures of SlyA by itself and bound to a high-affinity DNA operator sequence in the slyA gene. SlyA interacts with DNA through direct recognition of a guanine base by Arg-65, as well as interactions between conserved Arg-86 and the minor groove and a large network of non-base-specific contacts with the sugar phosphate backbone. Our structures, together with an unpublished structure of SlyA bound to the small molecule effector salicylate (Protein Data Bank code 3DEU), reveal that, unlike many other MarRmore » family proteins, SlyA dissociates from DNA without large conformational changes when bound to this effector. We propose that SlyA and other MarR global regulators rely more on indirect readout of DNA sequence to exert control over many genes, in contrast to proteins (such as OhrR) that recognize a single operator.« less

Simultaneous Drug Targeting of the Promoter MYC G-Quadruplex and BCL2 i-Motif in Diffuse Large B-Cell Lymphoma Delays Tumor Growth.

PubMed

Kendrick, Samantha; Muranyi, Andrea; Gokhale, Vijay; Hurley, Laurence H; Rimsza, Lisa M

2017-08-10

Secondary DNA structures are uniquely poised as therapeutic targets due to their molecular switch function in turning gene expression on or off and scaffold-like properties for protein and small molecule interaction. Strategies to alter gene transcription through these structures thus far involve targeting single DNA conformations. Here we investigate the feasibility of simultaneously targeting different secondary DNA structures to modulate two key oncogenes, cellular-myelocytomatosis (MYC) and B-cell lymphoma gene-2 (BCL2), in diffuse large B-cell lymphoma (DLBCL). Cotreatment with previously identified ellipticine and pregnanol derivatives that recognize the MYC G-quadruplex and BCL2 i-motif promoter DNA structures lowered mRNA levels and subsequently enhanced sensitivity to a standard chemotherapy drug, cyclophosphamide, in DLBCL cell lines. In vivo repression of MYC and BCL2 in combination with cyclophosphamide also significantly slowed tumor growth in DLBCL xenograft mice. Our findings demonstrate concurrent targeting of different DNA secondary structures offers an effective, precise, medicine-based approach to directly impede transcription and overcome aberrant pathways in aggressive malignancies.

Plasmid pVAX1-NH36 purification by membrane and bead perfusion chromatography.

PubMed

Franco-Medrano, Diana Ivonne; Guerrero-Germán, Patricia; Montesinos-Cisneros, Rosa María; Ortega-López, Jaime; Tejeda-Mansir, Armando

2017-03-01

The demand for plasmid DNA (pDNA) has increased in response to the rapid advances in vaccines applications to prevent and treat infectious diseases caused by virus, bacteria or parasites, such as Leishmania species. The immunization protocols require large amounts of supercoiled plasmid DNA (sc-pDNA) challenging the development of efficient and profitable processes for capturing and purified pDNA molecules from large volumes of lysates. A typical bioprocess involves four steps: fermentation, primary recovery, intermediate recovery and final purification. Ion-exchange chromatography is one of the key operations in the purification schemes of pDNA owing the chemical structure of these macromolecules. The goal of this research was to compare the performance of the final purification step of pDNA using ion-exchange chromatography on columns packed with Mustang Q membranes or perfusive beads POROS 50 HQ. The experimental results showed that both matrixes could separate the plasmid pVAX1-NH36 (3936 bp) from impurities in clarified Escherichia coli lysates with an adequate resolution. In addition, a 24- and 21-fold global purification factor was obtained. An 88 and 63% plasmid recuperation was achieved with ion-exchange membranes and perfusion beads, respectively. A better understanding of perfusion-based matrices for the purification of pDNA was developed in this research.

Transcriptional mapping of the ribosomal RNA region of mouse L-cell mitochondrial DNA.

PubMed Central

Nagley, P; Clayton, D A

1980-01-01

The map positions in mouse mitochondrial DNA of the two ribosomal RNA genes and adjacent genes coding several small transcripts have been determined precisely by application of a procedure in which DNA-RNA hybrids have been subjected to digestion by S1 nuclease under conditions of varying severity. Digestion of the DNA-RNA hybrids with S1 nuclease yielded a series of species which were shown to contain ribosomal RNA molecules together with adjacent transcripts hybridized conjointly to a continuous segment of mitochondrial DNA. There is one small transcript about 60 bases long whose gene adjoins the sequences coding the 5'-end of the small ribosomal RNA (950 bases) and which lies approximately 200 nucleotides from the D-loop origin of heavy strand mitochondrial DNA synthesis. An 80-base transcript lies between the small and large ribosomal RNA genes, and genes for two further short transcript (each about 80 bases in length) abut the sequences coding the 3'-end of the large ribosomal RNA (approximately 1500 bases). The ability to isolate a discrete DNA-RNA hybrid species approximately 2700 base pairs in length containing all these transcripts suggests that there can be few nucleotides in this region of mouse mitochondrial DNA which are not represented as stable RNA species. Images PMID:6253898

Single-molecule analysis of DNA uncoiling by a type II topoisomerase

NASA Astrophysics Data System (ADS)

Strick, Terence R.; Croquette, Vincent; Bensimon, David

2000-04-01

Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

Screening by imaging: scaling up single-DNA-molecule analysis with a novel parabolic VA-TIRF reflector and noise-reduction techniques.

PubMed

van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin

2009-09-21

Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.

Electron Microscopic Visualization of Protein Assemblies on Flattened DNA Origami.

PubMed

Mallik, Leena; Dhakal, Soma; Nichols, Joseph; Mahoney, Jacob; Dosey, Anne M; Jiang, Shuoxing; Sunahara, Roger K; Skiniotis, Georgios; Walter, Nils G

2015-07-28

DNA provides an ideal substrate for the engineering of versatile nanostructures due to its reliable Watson-Crick base pairing and well-characterized conformation. One of the most promising applications of DNA nanostructures arises from the site-directed spatial arrangement with nanometer precision of guest components such as proteins, metal nanoparticles, and small molecules. Two-dimensional DNA origami architectures, in particular, offer a simple design, high yield of assembly, and large surface area for use as a nanoplatform. However, such single-layer DNA origami were recently found to be structurally polymorphous due to their high flexibility, leading to the development of conformationally restrained multilayered origami that lack some of the advantages of the single-layer designs. Here we monitored single-layer DNA origami by transmission electron microscopy (EM) and discovered that their conformational heterogeneity is dramatically reduced in the presence of a low concentration of dimethyl sulfoxide, allowing for an efficient flattening onto the carbon support of an EM grid. We further demonstrated that streptavidin and a biotinylated target protein (cocaine esterase, CocE) can be captured at predesignated sites on these flattened origami while maintaining their functional integrity. Our demonstration that protein assemblies can be constructed with high spatial precision (within ∼2 nm of their predicted position on the platforms) by using strategically flattened single-layer origami paves the way for exploiting well-defined guest molecule assemblies for biochemistry and nanotechnology applications.

Inactive DNMT3B Splice Variants Modulate De Novo DNA Methylation

PubMed Central

Gordon, Catherine A.; Hartono, Stella R.; Chédin, Frédéric

2013-01-01

Inactive DNA methyltransferase (DNMT) 3B splice isoforms are associated with changes in DNA methylation, yet the mechanisms by which they act remain largely unknown. Using biochemical and cell culture assays, we show here that the inactive DNMT3B3 and DNMT3B4 isoforms bind to and regulate the activity of catalytically competent DNMT3A or DNMT3B molecules. DNMT3B3 modestly stimulated the de novo methylation activity of DNMT3A and also counteracted the stimulatory effects of DNMT3L, therefore leading to subtle and contrasting effects on activity. DNMT3B4, by contrast, significantly inhibited de novo DNA methylation by active DNMT3 molecules, most likely due to its ability to reduce the DNA binding affinity of co-complexes, thereby sequestering them away from their substrate. Immunocytochemistry experiments revealed that in addition to their effects on the intrinsic catalytic function of active DNMT3 enzymes, DNMT3B3 and DNMT34 drive distinct types of chromatin compaction and patterns of histone 3 lysine 9 tri-methylation (H3K9me3) deposition. Our findings suggest that regulation of active DNMT3 members through the formation of co-complexes with inactive DNMT3 variants is a general mechanism by which DNMT3 variants function. This may account for some of the changes in DNA methylation patterns observed during development and disease. PMID:23894490

Single DNA molecule detection using nanopipettes and nanoparticles.

PubMed

Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

2005-02-01

Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

Use of a small molecule as an initiator for interchain staudinger reaction: A new ATP sensing platform using product fluorescence.

PubMed

Yu, Huan; Zheng, Jing; Yang, Sheng; Asiri, Abdullah M; Alamry, Khalid A; Sun, Mingtai; Zhang, Kui; Wang, Suhua; Yang, Ronghua

2018-02-01

We demonstrated that a small molecule induced interchain Staudinger reaction can be employed for highly selective detection of adenosine triphosphate (ATP), an important energy-storage biomolecule. A designed ATP split aptamer (A1) was first functionalized with a weakly fluorescent coumarin derivative due to an azide group (azido-coumarin). The second DNA strand (A2) was covalently linked with triphenylphosphine, which could selectively and efficiently reduce azido to amino group through the Staudinger reaction. The A2 was then hybridized with a half of another designed longer DNA strand (T1). The second half of T1 was a split aptamer and selectively recognized ATP with A1 to form a sandwich structure. The specific interaction between ATP and the aptamers drew the two functionalized DNA strands (A1 and A2) together to initiate the interchain Staudinger reduction at fmol-nmol concentration level, hence produced fluorescent 7-aminocoumarin which could be used as an indicator for the presence of trace ATP. The reaction process had a concentration dependent manner with ATP in a large concentration range. Such a strategy of interchain Staudinger reaction can be extended to construct biosensors for other small functional molecules on the basis of judiciously designed aptamers. Copyright © 2017 Elsevier B.V. All rights reserved.

Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.

PubMed

Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R

2018-07-01

DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50  = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.

Method for in vitro recombination

DOEpatents

Gibson, Daniel Glenn; Smith, Hamilton O

2013-05-07

The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.

Biomolecular computers with multiple restriction enzymes

PubMed Central

Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

2017-01-01

Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases. PMID:29064510

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-04-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed Central

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-01-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

Mode Transition of RNA Trap by Electric and Hydraulic Force Field in Microfluidic Taper Shape Channel

NASA Astrophysics Data System (ADS)

Takamura, Yuzuru; Ueno, Kunimitsu; Nagasaka, Wako; Tomizawa, Yuichi; Tamiya, Eiichi

2007-03-01

We have discovered a phenomenon of accumulation of DNA near the constricted position of a microfluidic chip with taper shaped channel when both hydro pressure and electric field are applied in opposite directions. However, RNA has not been able to trap so far, unlike huge and uniformly double stranded DNA molecules, RNAs are smaller in size and single stranded with complicated conformation like blocks in lysed cell solution. In this paper, we will report not only large but also small RNA (100˜10b) are successfully trapped in relatively large microfluidic taper shape channel (width >10um). RNA are trapped in circular motion near the constricted position of taper shape channel, and the position and shape of the trapped RNA are controlled and make mode transition by changing the hydraulic and the electric force. Using this technique, smaller size molecule can be trapped in larger micro fluidic structure compared to the trap using dielectrophoresis. This technique is expected to establish easy and practical device as a direct total RNA extraction tool from living cells or tissues.

Nanoengineered capsules for selective SERS analysis of biological samples

NASA Astrophysics Data System (ADS)

You, Yil-Hwan; Schechinger, Monika; Locke, Andrea; Coté, Gerard; McShane, Mike

2018-02-01

Metal nanoparticles conjugated with DNA oligomers have been intensively studied for a variety of applications, including optical diagnostics. Assays based on aggregation of DNA-coated particles in proportion to the concentration of target analyte have not been widely adopted for clinical analysis, however, largely due to the nonspecific responses observed in complex biofluids. While sample pre-preparation such as dialysis is helpful to enable selective sensing, here we sought to prove that assay encapsulation in hollow microcapsules could remove this requirement and thereby facilitate more rapid analysis on complex samples. Gold nanoparticle-based assays were incorporated into capsules comprising polyelectrolyte multilayer (PEMs), and the response to small molecule targets and larger proteins were compared. Gold nanoparticles were able to selectively sense small Raman dyes (Rhodamine 6G) in the presence of large protein molecules (BSA) when encapsulated. A ratiometric based microRNA-17 sensing assay exhibited drastic reduction in response after encapsulation, with statistically-significant relative Raman intensity changes only at a microRNA-17 concentration of 10 nM compared to a range of 0-500 nM for the corresponding solution-phase response.

Conformational gating of DNA conductance

PubMed Central

Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M. P.; Hihath, Joshua

2015-01-01

DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature. PMID:26648400

Reliable method for generating double-stranded DNA vectors containing site-specific base modifications.

PubMed

Brégeon, Damien; Doetsch, Paul W

2004-11-01

Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.

Conformational gating of DNA conductance.

PubMed

Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M P; Hihath, Joshua

2015-12-09

DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature.

The Divided Bacterial Genome: Structure, Function, and Evolution.

PubMed

diCenzo, George C; Finan, Turlough M

2017-09-01

Approximately 10% of bacterial genomes are split between two or more large DNA fragments, a genome architecture referred to as a multipartite genome. This multipartite organization is found in many important organisms, including plant symbionts, such as the nitrogen-fixing rhizobia, and plant, animal, and human pathogens, including the genera Brucella , Vibrio , and Burkholderia . The availability of many complete bacterial genome sequences means that we can now examine on a broad scale the characteristics of the different types of DNA molecules in a genome. Recent work has begun to shed light on the unique properties of each class of replicon, the unique functional role of chromosomal and nonchromosomal DNA molecules, and how the exploitation of novel niches may have driven the evolution of the multipartite genome. The aims of this review are to (i) outline the literature regarding bacterial genomes that are divided into multiple fragments, (ii) provide a meta-analysis of completed bacterial genomes from 1,708 species as a way of reviewing the abundant information present in these genome sequences, and (iii) provide an encompassing model to explain the evolution and function of the multipartite genome structure. This review covers, among other topics, salient genome terminology; mechanisms of multipartite genome formation; the phylogenetic distribution of multipartite genomes; how each part of a genome differs with respect to genomic signatures, genetic variability, and gene functional annotation; how each DNA molecule may interact; as well as the costs and benefits of this genome structure. Copyright © 2017 American Society for Microbiology.

How to read and write mechanical information in DNA molecules

NASA Astrophysics Data System (ADS)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

The mitochondrial genome of the pathogenic yeast Candida subhashii: GC-rich linear DNA with a protein covalently attached to the 5′ termini

PubMed Central

Fricova, Dominika; Valach, Matus; Farkas, Zoltan; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Nosek, Jozef

2010-01-01

As a part of our initiative aimed at a large-scale comparative analysis of fungal mitochondrial genomes, we determined the complete DNA sequence of the mitochondrial genome of the yeast Candida subhashii and found that it exhibits a number of peculiar features. First, the mitochondrial genome is represented by linear dsDNA molecules of uniform length (29 795 bp), with an unusually high content of guanine and cytosine residues (52.7 %). Second, the coding sequences lack introns; thus, the genome has a relatively compact organization. Third, the termini of the linear molecules consist of long inverted repeats and seem to contain a protein covalently bound to terminal nucleotides at the 5′ ends. This architecture resembles the telomeres in a number of linear viral and plasmid DNA genomes classified as invertrons, in which the terminal proteins serve as specific primers for the initiation of DNA synthesis. Finally, although the mitochondrial genome of C. subhashii contains essentially the same set of genes as other closely related pathogenic Candida species, we identified additional ORFs encoding two homologues of the family B protein-priming DNA polymerases and an unknown protein. The terminal structures and the genes for DNA polymerases are reminiscent of linear mitochondrial plasmids, indicating that this genome architecture might have emerged from fortuitous recombination between an ancestral, presumably circular, mitochondrial genome and an invertron-like element. PMID:20395267

Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.

PubMed

Luan, Binquan; Zhou, Ruhong

2018-04-24

The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.

Heterologous mitochondrial DNA recombination in human cells.

PubMed

D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni

2004-12-15

Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.

Single Molecule Study of Metalloregulatory Protein-DNA Interactions

NASA Astrophysics Data System (ADS)

Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng

2007-03-01

Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.

Single-molecule study of the DNA denaturation phase transition in the force-torsion space.

PubMed

Salerno, D; Tempestini, A; Mai, I; Brogioli, D; Ziano, R; Cassina, V; Mantegazza, F

2012-09-14

We use the "magnetic tweezers" technique to show the structural transitions that the DNA undergoes in the force-torsion space. In particular, we focus on the regions corresponding to negative supercoiling. These regions are characterized by the formation of the so-called denaturation bubbles, which play an essential role in the replication and transcription of DNA. We experimentally map the region of the force-torsion space where the denaturation takes place. We observe that large fluctuations in DNA extension occur at one of the boundaries of this region, i.e., when the formation of denaturation bubbles and of plectonemes compete. To describe the experiments, we introduce a suitable extension of the classical model. The model correctly describes the position of the denaturation regions, the transition boundaries, and the measured values of the DNA extension fluctuations.

Single-Molecule Study of the DNA Denaturation Phase Transition in the Force-Torsion Space

NASA Astrophysics Data System (ADS)

Salerno, D.; Tempestini, A.; Mai, I.; Brogioli, D.; Ziano, R.; Cassina, V.; Mantegazza, F.

2012-09-01

We use the “magnetic tweezers” technique to show the structural transitions that the DNA undergoes in the force-torsion space. In particular, we focus on the regions corresponding to negative supercoiling. These regions are characterized by the formation of the so-called denaturation bubbles, which play an essential role in the replication and transcription of DNA. We experimentally map the region of the force-torsion space where the denaturation takes place. We observe that large fluctuations in DNA extension occur at one of the boundaries of this region, i.e., when the formation of denaturation bubbles and of plectonemes compete. To describe the experiments, we introduce a suitable extension of the classical model. The model correctly describes the position of the denaturation regions, the transition boundaries, and the measured values of the DNA extension fluctuations.

The suitability of DEAE-Cl active groups on customized poly(GMA-co-EDMA) continuous stationary phase for fast enzyme-free isolation of plasmid DNA.

PubMed

Danquah, Michael K; Forde, Gareth M

2007-06-15

The creation of a commercially viable and a large-scale purification process for plasmid DNA (pDNA) production requires a whole-systems continuous or semi-continuous purification strategy employing optimised stationary adsorption phase(s) without the use of expensive and toxic chemicals, avian/bovine-derived enzymes and several built-in unit processes, thus affecting overall plasmid recovery, processing time and economics. Continuous stationary phases are known to offer fast separation due to their large pore diameter making large molecule pDNA easily accessible with limited mass transfer resistance even at high flow rates. A monolithic stationary sorbent was synthesised via free radical liquid porogenic polymerisation of ethylene glycol dimethacrylate (EDMA) and glycidyl methacrylate (GMA) with surface and pore characteristics tailored specifically for plasmid binding, retention and elution. The polymer was functionalised with an amine active group for anion-exchange purification of pDNA from cleared lysate obtained from E. coli DH5alpha-pUC19 pellets in RNase/protease-free process. Characterization of the resin showed a unique porous material with 70% of the pores sizes above 300 nm. The final product isolated from anion-exchange purification in only 5 min was pure and homogenous supercoiled pDNA with no gDNA, RNA and protein contamination as confirmed with DNA electrophoresis, restriction analysis and SDS page. The resin showed a maximum binding capacity of 15.2 mg/mL and this capacity persisted after several applications of the resin. This technique is cGMP compatible and commercially viable for rapid isolation of pDNA.

Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

PubMed

Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

2018-02-07

Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

PubMed

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Efficient synthesis of supercoiled M13 DNA molecule containing a site specifically placed psoralen adduct and its use as a substrate for DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kodadek, T.; Gamper, H.

The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less

Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

DTIC Science & Technology

2015-10-01

several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects

C60 fullerene binding to DNA

NASA Astrophysics Data System (ADS)

Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

2014-09-01

Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

DNA-length-dependent quenching of fluorescently labeled iron oxide nanoparticles with gold, graphene oxide and MoS2 nanostructures.

PubMed

Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V

2014-08-13

We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

PubMed

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].

PubMed

Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R

2017-01-01

Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Nanomaterials Based on DNA

PubMed Central

Seeman, Nadrian C.

2012-01-01

The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

Enzymatic DNA molecules

NASA Technical Reports Server (NTRS)

Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

1998-01-01

The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.

Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

NASA Astrophysics Data System (ADS)

(O' Lee, Dominic J.

2018-02-01

At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

Self-consistent treatment of electrostatics in molecular DNA braiding through external forces.

PubMed

Lee, Dominic J

2014-06-01

In this paper we consider a physical system in which two DNA molecules braid about each other. The distance between the two molecular ends, on either side of the braid, is held at a distance much larger than supercoiling radius of the braid. The system is subjected to an external pulling force, and a moment that induces the braiding. In a model, developed for understanding such a system, we assume that each molecule can be divided into a braided and unbraided section. We also suppose that the DNA is nicked so that there is no constraint of the individual linking numbers of the molecules. Included in the model are steric and electrostatic interactions, thermal fluctuations of the braided and unbraided sections of the molecule, as well as the constraint on the braid linking (catenation) number. We compare two approximations used in estimating the free energy of the braided section. One is where the amplitude of undulations of one molecule with respect to the other is determined only by steric interactions. The other is a self-consistent determination of the mean-squared amplitude of these undulations. In this second approximation electrostatics should play an important role in determining this quantity, as suggested by physical arguments. We see that if the electrostatic interaction is sufficiently large there are indeed notable differences between the two approximations. We go on to test the self-consistent approximation-included in the full model-against experimental data for such a system, and we find good agreement. However, there seems to be a slight left-right-handed braid asymmetry in some of the experimental results. We discuss what might be the origin of this small asymmetry.

Preparation and self-folding of amphiphilic DNA origami.

PubMed

Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

2015-03-01

Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

End labeling procedures: an overview.

PubMed

Hilario, Elena

2004-09-01

There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.

Elongated unique DNA strand deposition on microstructured substrate by receding meniscus assembly and capillary force

PubMed Central

Charlot, B.; Bardin, F.; Sanchez, N.; Roux, P.; Teixeira, S.; Schwob, E.

2014-01-01

Ordered deposition of elongated DNA molecules was achieved by the forced dewetting of a DNA solution droplet over a microstructured substrate. This technique allows trapping, uncoiling, and deposition of DNA fragments without the need of a physicochemical anchoring of the molecule and results in the combing of double stranded DNA from the edge of microwells on a polydimethylsiloxane (PDMS) substrate. The technique involves scanning a droplet of DNA solution caught between a movable blade and a PDMS substrate containing an array of microwells. The deposition and elongation appears when the receding meniscus dewets microwells, the latter acting here as a perturbation in the dewetting line forcing the water film to break locally. Thus, DNA molecules can be deposited in an ordered manner and elongated conformation based solely on a physical phenomenon, allowing uncoiled DNA molecules to be observed in all their length. However, the exact mechanism that governs the deposition of DNA strands is not well understood. This paper is an analysis of the physical phenomenon occurring in the deposition process and is based on observations made with the use of high frame/second rate video microscopy. PMID:24753724

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

PubMed

Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

DNA gel electrophoresis: the reptation model(s).

PubMed

Slater, Gary W

2009-06-01

DNA gel electrophoresis has been the most important experimental tool to separate DNA fragments for several decades. The introduction of PFGE in the 1980s and capillary gel electrophoresis in the 1990s made it possible to study, map and sequence entire genomes. Explaining how very large DNA molecules move in a gel and why PFGE is needed to separate them has been an active field of research ever since the launch of the journal Electrophoresis. This article presents a personal and historical overview of the development of the theory of gel electrophoresis, focusing on the reptation model, the band broadening mechanisms, and finally the factors that limit the read length and the resolution of electrophoresis-based sequencing systems. I conclude with a short discussion of some of the questions that remain unanswered.

3D DNA Crystals and Nanotechnology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paukstelis, Paul; Seeman, Nadrian

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

3D DNA Crystals and Nanotechnology

DOE PAGES

Paukstelis, Paul; Seeman, Nadrian

2016-08-18

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions

PubMed Central

Brown, Maxwell W.; Kim, Yoori; Williams, Gregory M.; Huck, John D.; Surtees, Jennifer A.; Finkelstein, Ilya J.

2016-01-01

DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2–Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2–Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2–Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2–Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2–Msh3 and Msh2–Msh6 navigate on a crowded genome and suggest how Msh2–Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705

Selfish Little Circles: Transmission Bias and Evolution of Large Deletion-Bearing Mitochondrial DNA in Caenorhabditis briggsae Nematodes

PubMed Central

Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.

2012-01-01

Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maaloum, M.; Muller, P.; Beker, A-F.

Almost two decades ago, measurements of force versus extension on isolated double-stranded DNA molecules revealed a force plateau. This unusual stretching phenomenon in DNA suggests that the long molecules may be extended from the usual B form into a new conformation. Different models have been proposed to describe the nature of DNA in its stretched form, S-DNA. Using atomic force microscopy combined with a molecular combing method, we identified the structure of {lambda}-phage DNA for different stretching values. We provide strong evidence for the existence of a first-order transition between B form and S form. Beyond a certain extension ofmore » the natural length, DNA molecules adopt a new double-helix conformation characterized by a diameter of 1.2 nm and a helical pitch of18 nm.« less

Measurement of DNA translocation dynamics in a solid-state nanopore at 100-ns temporal resolution

PubMed Central

Shekar, Siddharth; Niedzwiecki, David J.; Chien, Chen-Chi; Ong, Peijie; Fleischer, Daniel A.; Lin, Jianxun; Rosenstein, Jacob K.; Drndic, Marija; Shepard, Kenneth L.

2017-01-01

Despite the potential for nanopores to be a platform for high-bandwidth study of single-molecule systems, ionic current measurements through nanopores have been limited in their temporal resolution by noise arising from poorly optimized measurement electronics and large parasitic capacitances in the nanopore membranes. Here, we present a complementary metal-oxide-semiconductor (CMOS) nanopore (CNP) amplifier capable of low noise recordings at an unprecedented 10 MHz bandwidth. When integrated with state-of-the-art solid-state nanopores in silicon nitride membranes, we achieve an SNR of greater than 10 for ssDNA translocations at a measurement bandwidth of 5 MHz, which represents the fastest ion current recordings through nanopores reported to date. We observe transient features in ssDNA translocation events that are as short as 200 ns, which are hidden even at bandwidths as high as 1 MHz. These features offer further insights into the translocation kinetics of molecules entering and exiting the pore. This platform highlights the advantages of high-bandwidth translocation measurements made possible by integrating nanopores and custom-designed electronics. PMID:27332998

Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

PubMed Central

Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

2012-01-01

RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes

PubMed Central

Simons, Michelle; Szczelkun, Mark D.

2011-01-01

The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244

Multiplexed Sequence Encoding: A Framework for DNA Communication.

PubMed

Zakeri, Bijan; Carr, Peter A; Lu, Timothy K

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.

Computational Approaches to Nucleic Acid Origami.

PubMed

Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo

2015-10-12

Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.

Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

PubMed

Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

2012-12-01

To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

Supercoiled circular DNA of an insect granulosis virus

PubMed Central

Tweeten, Kathleen A.; Bulla, Lee A.; Consigli, Richard A.

1977-01-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of 3H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 × 106 by sedimentation in neutral sucrose and 78 × 106 by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 × 106. The buoyant density of the granulosis virus DNA was 1.703 g/cm3 and that of its insect host DNA was 1.697 g/cm3. Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively. Images PMID:198791

Supercoiled circular DNA of an insect granulosis virus.

PubMed

Tweeten, K A; Bulla, L A; Consigli, R A

1977-08-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

Mass transport through vertically aligned large diameter MWCNT embedded in parylene

PubMed Central

Krishnakumar, P; Tiwari, P B; Staples, S; Luo, T; Darici, Y; He, J; Lindsay, SM

2013-01-01

We have fabricated porous membranes using a parylene encapsulated vertically aligned forest of multi-walled carbon nanotube (MWCNT, about 7nm inner diameter). The transport of charged particles in electrolyte through these membranes was studied by applying electric field and pressure. Under an electric field in the range of 4.4×104 V/m, electrophoresis instead of electroomosis is found to be the main mechanism for ion transport. Small molecules and 5 nm gold nanoparticles can be driven through the membranes by an electric field. However, small biomolecules, like DNA oligomers, cannot. Due to the weak electric driving force, the interactions between charged particles and the hydrophobic CNT inner surface play important roles in the transport, leading to enhanced selectivity for small molecules. Simple chemical modification on the CNT ends also induces an obvious effect on the translocation of single strand DNA oligomer and gold nanoparticle under a modest pressure (<294 Pa). PMID:23064678

Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

PubMed

Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

2013-07-01

The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

Attachment of reporter groups to specific, selected cytidine residues in RNA using a bisulfite-catalyzed transamination reaction.

PubMed Central

Draper, D E

1984-01-01

Bisulfite catalyzes transamination of cytidine at the N4 position; the suitability of this reaction for attaching reporter groups to selected cytidine residues in RNA molecules has been investigated. Poly(C) is nearly quantitatively converted to the poly (N4 aminoethyl-C) derivative after 3 hrs at 42 degrees C with ethylene diamine (pK1 = 7.6) and bisulfite. This derivative reacts quantitatively with N-hydroxysuccinimide esters; the linkage of a fluorescent dye, nitrobenzofurazan, to cytidine by this reaction is demonstrated. To direct the bisulfite reaction to selected cytidines within a large RNA molecule, the RNA is hybridized to complementary DNA containing a deletion. Only the cytidines in the single strand RNA loop (corresponding to the DNA deletion) are reactive. Two cytidines in the middle of a 340 base RNA fragment from 16S ribosomal RNA have been modified by this technique. Images PMID:6198634

Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

PubMed

Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

2008-09-01

We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

DNA nanotechnology-enabled biosensors.

PubMed

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

NASA Astrophysics Data System (ADS)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

PubMed Central

Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

2015-01-01

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Structure and Environment Influence in DNA Conduction

NASA Technical Reports Server (NTRS)

Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

2002-01-01

Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

Imaging and sizing of single DNA molecules on a mobile phone.

PubMed

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2014-12-23

DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

PubMed Central

McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

2016-01-01

We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

Compiler-aided systematic construction of large-scale DNA strand displacement circuits using unpurified components

NASA Astrophysics Data System (ADS)

Thubagere, Anupama J.; Thachuk, Chris; Berleant, Joseph; Johnson, Robert F.; Ardelean, Diana A.; Cherry, Kevin M.; Qian, Lulu

2017-02-01

Biochemical circuits made of rationally designed DNA molecules are proofs of concept for embedding control within complex molecular environments. They hold promise for transforming the current technologies in chemistry, biology, medicine and material science by introducing programmable and responsive behaviour to diverse molecular systems. As the transformative power of a technology depends on its accessibility, two main challenges are an automated design process and simple experimental procedures. Here we demonstrate the use of circuit design software, combined with the use of unpurified strands and simplified experimental procedures, for creating a complex DNA strand displacement circuit that consists of 78 distinct species. We develop a systematic procedure for overcoming the challenges involved in using unpurified DNA strands. We also develop a model that takes synthesis errors into consideration and semi-quantitatively reproduces the experimental data. Our methods now enable even novice researchers to successfully design and construct complex DNA strand displacement circuits.

High-Throughput DNA sequencing of ancient wood.

PubMed

Wagner, Stefanie; Lagane, Frédéric; Seguin-Orlando, Andaine; Schubert, Mikkel; Leroy, Thibault; Guichoux, Erwan; Chancerel, Emilie; Bech-Hebelstrup, Inger; Bernard, Vincent; Billard, Cyrille; Billaud, Yves; Bolliger, Matthias; Croutsch, Christophe; Čufar, Katarina; Eynaud, Frédérique; Heussner, Karl Uwe; Köninger, Joachim; Langenegger, Fabien; Leroy, Frédéric; Lima, Christine; Martinelli, Nicoletta; Momber, Garry; Billamboz, André; Nelle, Oliver; Palomo, Antoni; Piqué, Raquel; Ramstein, Marianne; Schweichel, Roswitha; Stäuble, Harald; Tegel, Willy; Terradas, Xavier; Verdin, Florence; Plomion, Christophe; Kremer, Antoine; Orlando, Ludovic

2018-03-01

Reconstructing the colonization and demographic dynamics that gave rise to extant forests is essential to forecasts of forest responses to environmental changes. Classical approaches to map how population of trees changed through space and time largely rely on pollen distribution patterns, with only a limited number of studies exploiting DNA molecules preserved in wooden tree archaeological and subfossil remains. Here, we advance such analyses by applying high-throughput (HTS) DNA sequencing to wood archaeological and subfossil material for the first time, using a comprehensive sample of 167 European white oak waterlogged remains spanning a large temporal (from 550 to 9,800 years) and geographical range across Europe. The successful characterization of the endogenous DNA and exogenous microbial DNA of 140 (~83%) samples helped the identification of environmental conditions favouring long-term DNA preservation in wood remains, and started to unveil the first trends in the DNA decay process in wood material. Additionally, the maternally inherited chloroplast haplotypes of 21 samples from three periods of forest human-induced use (Neolithic, Bronze Age and Middle Ages) were found to be consistent with those of modern populations growing in the same geographic areas. Our work paves the way for further studies aiming at using ancient DNA preserved in wood to reconstruct the micro-evolutionary response of trees to climate change and human forest management. © 2018 John Wiley & Sons Ltd.

Illegitimate recombination mediated by calf thymus DNA topoisomerase II in vitro.

PubMed Central

Bae, Y S; Kawasaki, I; Ikeda, H; Liu, L F

1988-01-01

We have found that purified calf thymus DNA topoisomerase II mediates recombination between two phage lambda DNA molecules in an in vitro system. The enzyme mainly produced a linear monomer recombinant DNA that can be packaged in vitro. Novobiocin and anti-calf thymus DNA topoisomerase II antibody inhibit this ATP-dependent recombination. The recombinant molecules contain duplications or deletions, and most crossovers take place between nonhomologous sequences of lambda DNA, as judged by the sequences of recombination junctions. Therefore, the recombination mediated by the calf thymus DNA topoisomerase II is an illegitimate recombination that is similar to recombination mediated by Escherichia coli DNA gyrase or phage T4 DNA topoisomerase. The subunit exchange model, which has been suggested for the DNA gyrase-mediated recombination, is now generalized as follows: DNA topoisomerase II molecules bind to DNAs, associate with each other, and lead to the exchange of DNA strands through the exchange of topoisomerase II subunits. Illegitimate recombination might be carried out by a general mechanism in organisms ranging from prokaryotes to higher eukaryotes. Images PMID:2832845

Microfluidic DNA sample preparation method and device

DOEpatents

Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.

2002-01-01

Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

Exploring protein-DNA interactions in 3D using in situ construction, manipulation, and visualization of individual DNA-dumbbells with optical traps, microfluidics, and fluorescence microscopy

PubMed Central

Forget, Anthony L.; Dombrowski, Christopher C.; Amitani, Ichiro; Kowalczykowski, Stephen C.

2015-01-01

In this Protocol, we describe a procedure to generate ‘DNA-dumbbells’ — single molecules of DNA with a microscopic bead attached at each end — and techniques for manipulating individual DNA-dumbbells. We also detail the design and fabrication of a microfluidic device (flow cell) used in conjunction with dual optical trapping to manipulate DNA-dumbbells and to visualize individual protein–DNA complexes by single-molecule epifluorescence microscopy. Our design of the flow cell enables the rapid movement of trapped molecules between laminar flow channels and a flow-free ‘reservoir’. The reservoir provides the means to examine formation of DNA–protein complexes in solution in the absence of external flow forces, while still maintaining a predetermined end-to-end extension of the DNA. These features facilitate examination of the role of three-dimensional DNA conformation and dynamics in protein–DNA interactions. Preparation of flow cells and reagents requires two days each; in situ DNA-dumbbell assembly and imaging of single protein–DNA complexes requires another day. PMID:23411634

Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2010-03-01

Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

Non-random distribution of DNA double-strand breaks induced by particle irradiation

NASA Technical Reports Server (NTRS)

Lobrich, M.; Cooper, P. K.; Rydberg, B.; Chatterjee, A. (Principal Investigator)

1996-01-01

Induction of DNA double-strand breaks (dsbs) in mammalian cells is dependent on the spatial distribution of energy deposition from the ionizing radiation. For high LET particle radiations the primary ionization sites occur in a correlated manner along the track of the particles, while for X-rays these sites are much more randomly distributed throughout the volume of the cell. It can therefore be expected that the distribution of dsbs linearly along the DNA molecule also varies with the type of radiation and the ionization density. Using pulsed-field gel and conventional gel techniques, we measured the size distribution of DNA molecules from irradiated human fibroblasts in the total range of 0.1 kbp-10 Mbp for X-rays and high LET particles (N ions, 97 keV/microns and Fe ions, 150 keV/microns). On a mega base pair scale we applied conventional pulsed-field gel electrophoresis techniques such as measurement of the fraction of DNA released from the well (FAR) and measurement of breakage within a specific NotI restriction fragment (hybridization assay). The induction rate for widely spaced breaks was found to decrease with LET. However, when the entire distribution of radiation-induced fragments was analysed, we detected an excess of fragments with sizes below about 200 kbp for the particles compared with X-irradiation. X-rays are thus more effective than high LET radiations in producing large DNA fragments but less effective in the production of smaller fragments. We determined the total induction rate of dsbs for the three radiations based on a quantitative analysis of all the measured radiation-induced fragments and found that the high LET particles were more efficient than X-rays at inducing dsbs, indicating an increasing total efficiency with LET. Conventional assays that are based only on the measurement of large fragments are therefore misleading when determining total dsb induction rates of high LET particles. The possible biological significance of this non-randomness for dsb induction is discussed.

Optical determination of the electronic coupling and intercalation geometry of thiazole orange homodimer in DNA

NASA Astrophysics Data System (ADS)

Cunningham, Paul D.; Bricker, William P.; Díaz, Sebastián A.; Medintz, Igor L.; Bathe, Mark; Melinger, Joseph S.

2017-08-01

Sequence-selective bis-intercalating dyes exhibit large increases in fluorescence in the presence of specific DNA sequences. This property makes this class of fluorophore of particular importance to biosensing and super-resolution imaging. Here we report ultrafast transient anisotropy measurements of resonance energy transfer (RET) between thiazole orange (TO) molecules in a complex formed between the homodimer TOTO and double-stranded (ds) DNA. Biexponential homo-RET dynamics suggest two subpopulations within the ensemble: 80% intercalated and 20% non-intercalated. Based on the application of the transition density cube method to describe the electronic coupling and Monte Carlo simulations of the TOTO/dsDNA geometry, the dihedral angle between intercalated TO molecules is estimated to be 81° ± 5°, corresponding to a coupling strength of 45 ± 22 cm-1. Dye intercalation with this geometry is found to occur independently of the underlying DNA sequence, despite the known preference of TOTO for the nucleobase sequence CTAG. The non-intercalated subpopulation is inferred to have a mean inter-dye separation distance of 19 Å, corresponding to coupling strengths between 0 and 25 cm-1. This information is important to enable the rational design of energy transfer systems that utilize TOTO as a relay dye. The approach used here is generally applicable to determining the electronic coupling strength and intercalation configuration of other dimeric bis-intercalators.

Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

PubMed Central

Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

2014-01-01

The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

A 3D-DNA Molecule Made of PlayMais

ERIC Educational Resources Information Center

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Characterization of the geometry and topology of DNA pictured as a discrete collection of atoms

PubMed Central

Olson, Wilma K.

2014-01-01

The structural and physical properties of DNA are closely related to its geometry and topology. The classical mathematical treatment of DNA geometry and topology in terms of ideal smooth space curves was not designed to characterize the spatial arrangements of atoms found in high-resolution and simulated double-helical structures. We present here new and rigorous numerical methods for the rapid and accurate assessment of the geometry and topology of double-helical DNA structures in terms of the constituent atoms. These methods are well designed for large DNA datasets obtained in detailed numerical simulations or determined experimentally at high-resolution. We illustrate the usefulness of our methodology by applying it to the analysis of three canonical double-helical DNA chains, a 65-bp minicircle obtained in recent molecular dynamics simulations, and a crystallographic array of protein-bound DNA duplexes. Although we focus on fully base-paired DNA structures, our methods can be extended to treat the geometry and topology of melted DNA structures as well as to characterize the folding of arbitrary molecules such as RNA and cyclic peptides. PMID:24791158

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Building block synthesis using the polymerase chain assembly method.

PubMed

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

PubMed

Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

2014-08-20

DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

PubMed

Zakian, V A; Brewer, B J; Fangman, W L

1979-08-01

Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA molecule is identical to that which controls the initiation of chromosomal DNA.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

2011-01-18

A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

Prominent mitochondrial DNA recombination intermediates in human heart muscle.

PubMed

Kajander, O A; Karhunen, P J; Holt, I J; Jacobs, H T

2001-11-01

Recombination intermediates containing four-way (Holliday) junctions are generated during DNA repair and replication in many systems, including yeast mitochondrial DNA (mtDNA). In contrast, convincing evidence for recombination in mammalian mtDNA is lacking. We have used two-dimensional agarose-gel electrophoresis to analyse non-linear forms of mtDNA in human heart muscle. Replication intermediates from both the coupled and strand-asynchronous mtDNA replication pathways were detected. An additional class of non-linear molecules, with the electrophoretic properties of four-way junctions, was also prominent. These molecules were insensitive to topoisomerase I or RNase H, but were diminished by branch migration or RuvC treatment. Junctional molecules were detected in all regions of the mitochondrial genome, were found in myocardial DNA from young and old adults, but were present at lower levels in skeletal muscle and placenta. We suggest that they could represent intermediates of mtDNA repair, given their prevalence in the oxyradical-rich environment of heart muscle mitochondria.

Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

PubMed

Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

2001-08-01

DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

Animal Mitochondrial DNA as We Do Not Know It: mt-Genome Organization and Evolution in Nonbilaterian Lineages

PubMed Central

Pett, Walker

2016-01-01

Abstract Animal mitochondrial DNA (mtDNA) is commonly described as a small, circular molecule that is conserved in size, gene content, and organization. Data collected in the last decade have challenged this view by revealing considerable diversity in animal mitochondrial genome organization. Much of this diversity has been found in nonbilaterian animals (phyla Cnidaria, Ctenophora, Placozoa, and Porifera), which, from a phylogenetic perspective, form the main branches of the animal tree along with Bilateria. Within these groups, mt-genomes are characterized by varying numbers of both linear and circular chromosomes, extra genes (e.g. atp9, polB, tatC), large variation in the number of encoded mitochondrial transfer RNAs (tRNAs) (0–25), at least seven different genetic codes, presence/absence of introns, tRNA and mRNA editing, fragmented ribosomal RNA genes, translational frameshifting, highly variable substitution rates, and a large range of genome sizes. This newly discovered diversity allows a better understanding of the evolutionary plasticity and conservation of animal mtDNA and provides insights into the molecular and evolutionary mechanisms shaping mitochondrial genomes. PMID:27557826

DNA conformation on surfaces measured by fluorescence self-interference.

PubMed

Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

2006-02-21

The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

PubMed Central

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Structural Transitions in Supercoiled Stretched DNA

NASA Astrophysics Data System (ADS)

v, Croquette

1998-03-01

Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

DNA under Force: Mechanics, Electrostatics, and Hydration.

PubMed

Li, Jingqiang; Wijeratne, Sithara S; Qiu, Xiangyun; Kiang, Ching-Hwa

2015-02-25

Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

An improved DNA force field for ssDNA interactions with gold nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Xiankai; Huai, Ping; Fan, Chunhai

The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones “protecting” hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thusmore » the “protection” by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.« less

An improved DNA force field for ssDNA interactions with gold nanoparticles

NASA Astrophysics Data System (ADS)

Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo

2014-06-01

The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.

An improved DNA force field for ssDNA interactions with gold nanoparticles.

PubMed

Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo

2014-06-21

The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.

Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.

PubMed

Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C

1992-07-01

A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.

DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2005-06-14

An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

PubMed Central

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

[Single-molecule detection and characterization of DNA replication based on DNA origami].

PubMed

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2012-02-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

Multiplexed Sequence Encoding: A Framework for DNA Communication

PubMed Central

Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

A single molecule study of G-quadruplex and short duplex DNA structures

NASA Astrophysics Data System (ADS)

Roy, William A., Jr.

Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

NASA Astrophysics Data System (ADS)

Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

2013-10-01

Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

Dynamic binding of replication protein a is required for DNA repair

PubMed Central

Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

2016-01-01

Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

DNA-assisted oligomerization of pore-forming toxin monomers into precisely-controlled protein channels

PubMed Central

Knechtel, Johann

2017-01-01

Abstract We have developed a novel approach for creating membrane-spanning protein-based pores. The construction principle is based on using well-defined, circular DNA nanostructures to arrange a precise number of pore-forming protein toxin monomers. We can thereby obtain, for the first time, protein pores with specifically set diameters. We demonstrate this principle by constructing artificial alpha-hemolysin (αHL) pores. The DNA/αHL hybrid nanopores composed of twelve, twenty or twenty-six monomers show stable insertions into lipid bilayers during electrical recordings, along with steady, pore size-dependent current levels. Our approach successfully advances the applicability of nanopores, in particular towards label-free studies of single molecules in large nanoscaled biological structures. PMID:29088457

High flexibility of DNA on short length scales probed by atomic force microscopy.

PubMed

Wiggins, Paul A; van der Heijden, Thijn; Moreno-Herrero, Fernando; Spakowitz, Andrew; Phillips, Rob; Widom, Jonathan; Dekker, Cees; Nelson, Philip C

2006-11-01

The mechanics of DNA bending on intermediate length scales (5-100 nm) plays a key role in many cellular processes, and is also important in the fabrication of artificial DNA structures, but previous experimental studies of DNA mechanics have focused on longer length scales than these. We use high-resolution atomic force microscopy on individual DNA molecules to obtain a direct measurement of the bending energy function appropriate for scales down to 5 nm. Our measurements imply that the elastic energy of highly bent DNA conformations is lower than predicted by classical elasticity models such as the worm-like chain (WLC) model. For example, we found that on short length scales, spontaneous large-angle bends are many times more prevalent than predicted by the WLC model. We test our data and model with an interlocking set of consistency checks. Our analysis also shows how our model is compatible with previous experiments, which have sometimes been viewed as confirming the WLC.

The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

NASA Astrophysics Data System (ADS)

Xi, Dong; Luo, XiaoPing; Lu, QiangHua; Yao, KaiLun; Liu, ZuLi; Ning, Qin

2008-03-01

Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method.

Scaleable processes for the manufacture of therapeutic quantities of plasmid DNA.

PubMed

Shamlou, Parviz Ayazi

2003-06-01

The need for scaleable processes to manufacture therapeutic plasmid DNA (pDNA) is easy to overlook when attention is focused primarily on vector design and establishment of early clinical results. pDNA is a large molecule and has properties that are similar to those of the contaminating chromosomal DNA. These, combined with the low initial concentration of plasmids in the host cell, provide unique process challenges that require significant upfront design to establish robust manufacturing processes that can also comply with current Good Manufacturing Practice ('cGMP') and produce milligram-to-kilogram quantities of pDNA product. This review describes promising scaleable processes that are currently being assessed for production of therapeutic supercoiled pDNA. Fermentation strategies for improving supercoiled plasmid yield and reducing contaminant concentrations are reviewed, and downstream processes are assessed for their ability to efficiently remove cellular contaminants, separate the supercoiled form of the pDNA from its open circular and linear forms, and prepare the purified drug substance for formulation. Current strategies are presented for developing stable delivery systems, and approaches to quality assurance and quality control are discussed.

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

PubMed

Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

2013-04-01

Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

PubMed

Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

2018-06-04

The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Of Molecules and Models.

ERIC Educational Resources Information Center

Brinner, Bonnie

1992-01-01

Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)

Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

NASA Astrophysics Data System (ADS)

Huschka, Ryan

Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

PubMed Central

Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

2013-01-01

Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

PubMed

Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

2007-03-01

Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

Single-molecule DNA detection with an engineered MspA protein nanopore

PubMed Central

Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

2008-01-01

Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Definition of the persistence length in the coarse-grained models of DNA elasticity.

PubMed

Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

2012-11-01

By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

DNA motion capture reveals the mechanical properties of DNA at the mesoscale.

PubMed

Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J

2015-05-19

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Effect of DNA-CTMA complex on optical properties of LDS 821 dye

NASA Astrophysics Data System (ADS)

Udayan, Sony; Ramachandran, Vijesh Kavumoottil; Sebastian, Mathew; Chandran, Pradeep; Nampoori, Vadakkedath Parameswaran Narayanan; Thomas, Sheenu

2017-07-01

We have investigated the fluorescence behavior of LDS 821 dye (Styryl 9 M) with deoxyribonucleic acid attached with cetyltrimethyl-ammonium (DNA-CTMA). Optical absorption studies confirm the intercalation of the dye molecules with DNA-CTMA. Fluorescence studies show an enhancement of fluorescence intensity of dye with DNA-CTMA, which suggest the reduction of TICT states of the dye molecule. The FWHM of the fluorescence spectrum increases from 95 nm to 161 nm indicating the formation of new energy levels when DNA-CTMA forms a complex with LDS 821 dye. Fluorescence lifetime measurements shows that lifetime of LDS 821 varies from 507ps to 953 ps with the addition of DNA-CTMA, which also confirms the deactivation of TICT states of dye molecule. Results show that the incorporation of DNA-CTMA with LDS 821 dye improves the optical characteristics of LDS 821 dye and therefore, can be used as a good fluorescence probe for DNA visualization as well as in lasing applications.

Nano-funnels as electro-osmotic ``tweezers and pistons''

NASA Astrophysics Data System (ADS)

Wang, Yanqian; Panyukov, Sergey; Zhou, Jinsheng; Menard, Laurent D.; Ramsey, J. Michael; Rubinstien, Michael

2014-03-01

An electric field is used to force a DNA molecule into a nano-channel by compensating the free energy penalty that results from the reduced conformational entropy of the confined macromolecule. Narrow nano-channels require high critical electric fields to achieve DNA translocation, leading to short dwell times of DNA in these channels. We demonstrate that nano-funnels integrated with nano-channels reduce the free energy barrier and lower the critical electric field required for DNA translocation. A focused electric field within the funnel increases the electric force on the DNA, compresses the molecule, and increases the osmotic pressure at the nano-channel entrance. This ``electro-osmotic piston'' forces the molecule into the nano-channel at lower electric fields than those observed without the funnel. Appropirately designed nano-funnels can also function as tweezers that allow manipulation of the position of the DNA molecule. The predictions of our theory describing double-stranded DNA behavior in nano-funnel - nano-channel devices are consistent with experimental results. Thanks for the financial support from NSF (DMR-1309892, DMR-1121107, DMR-1122483), NIH (1-P50-HL107168, 1-P01-HL108808-01A1, R01HG02647), NHGRI and CF Foundation.

Model systems for single molecule polymer dynamics

PubMed Central

Latinwo, Folarin

2012-01-01

Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy

PubMed Central

Sett, S.; Ghosh, S.; Rakshit, T.; Mukhopadhyay, R.

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA—the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA—the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time. PMID:27183010

Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure

PubMed Central

North, Justin A.; Šimon, Marek; Ferdinand, Michelle B.; Shoffner, Matthew A.; Picking, Jonathan W.; Howard, Cecil J.; Mooney, Alex M.; van Noort, John; Poirier, Michael G.; Ottesen, Jennifer J.

2014-01-01

Nucleosomes contain ∼146 bp of DNA wrapped around a histone protein octamer that controls DNA accessibility to transcription and repair complexes. Posttranslational modification (PTM) of histone proteins regulates nucleosome function. To date, only modest changes in nucleosome structure have been directly attributed to histone PTMs. Histone residue H3(T118) is located near the nucleosome dyad and can be phosphorylated. This PTM destabilizes nucleosomes and is implicated in the regulation of transcription and repair. Here, we report gel electrophoretic mobility, sucrose gradient sedimentation, thermal disassembly, micrococcal nuclease digestion and atomic force microscopy measurements of two DNA–histone complexes that are structurally distinct from nucleosomes. We find that H3(T118ph) facilitates the formation of a nucleosome duplex with two DNA molecules wrapped around two histone octamers, and an altosome complex that contains one DNA molecule wrapped around two histone octamers. The nucleosome duplex complex forms within short ∼150 bp DNA molecules, whereas altosomes require at least ∼250 bp of DNA and form repeatedly along 3000 bp DNA molecules. These results are the first report of a histone PTM significantly altering the nucleosome structure. PMID:24561803

Model Checking Temporal Logic Formulas Using Sticker Automata

PubMed Central

Feng, Changwei; Wu, Huanmei

2017-01-01

As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method. PMID:29119114

Conjugates of classical DNA/RNA binder with nucleobase: chemical, biochemical and biomedical applications.

PubMed

Saftic, Dijana; Ban, Zeljka; Matic, Josipa; Tumir, Lidija-Marija; Piantanida, Ivo

2018-05-07

Among the most intensively studied classes of small molecules (molecular weight < 650) in biomedical research are small molecules that non-covalently bind to DNA/RNA, and another intensively studied class are nucleobase derivatives. Both classes have been intensively elaborated in many books and reviews. However, conjugates consisting of DNA/RNA binder covalently linked to nucleobase are much less studied and have not been reviewed in the last two decades. Therefore, this review summarized reports on the design of classical DNA/RNA binder - nucleobase conjugates, as well as data about their interactions with various DNA or RNA targets, and even in some cases protein targets involved. According to these data, the most important structural aspects of selective or even specific recognition between small molecule and target are proposed, and where possible related biochemical and biomedical aspects were discussed. The general conclusion is that this, rather new class of molecules showed an amazing set of recognition tools for numerous DNA or RNA targets in the last two decades, as well as few intriguing in vitro and in vivo selectivities. Several lead research lines show promising advancements toward either novel, highly selective markers or bioactive, potentially druggable molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel

NASA Astrophysics Data System (ADS)

He, Lidong

Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.

DNA curtains for high-throughput single-molecule optical imaging.

PubMed

Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis

2010-01-01

Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.

The Apis mellifera Filamentous Virus Genome

PubMed Central

Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D.; de Miranda, Joachim R.; Neumann, Peter

2015-01-01

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family. PMID:26184284

The Apis mellifera Filamentous Virus Genome.

PubMed

Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D; de Miranda, Joachim R; Neumann, Peter

2015-07-09

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family.

Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

NASA Technical Reports Server (NTRS)

Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel

1990-01-01

Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

PubMed Central

Pérez, J J; Portugal, J

1990-01-01

It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

PubMed

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion between mutant and wild type mtDNA molecules is not a consequence of a random repopulation of depleted pool of mtDNA genomes. The heteroplasmy change could be also modulated by cell growth conditions, namely increased by cells culturing in a carbohydrate-free medium, thus forcing them to use oxidative phosphorylation and providing a selective advantage for cells with improved respiration capacities. We discuss the advantages and limitations of this approach and propose further development of the anti-replicative strategy based on the RNA import into human mitochondria.

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

PubMed Central

2015-01-01

Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

NASA Astrophysics Data System (ADS)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

PubMed

Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

2014-04-01

The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

PubMed

Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

2015-10-07

To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

Integrity and Biological Activity of DNA after UV Exposure

NASA Astrophysics Data System (ADS)

Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.

2010-04-01

The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.

An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

PubMed

Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

2006-10-01

In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

PubMed

Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

2018-02-19

Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

An effective model of DNA like helicoidal structure: with length fluctuation nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2011-03-01

One of the natural helicoidal nanostructure, which thermomechanical features are studied carefully with the help of different mechanical models, is a DNA cell / molecule. Our study proves that the experimentally determined nonlinear fluctuations of the molecular length of DNA can be better understood by modeling the molecule as a helicoidal pretwisted nanostrip sensor with nonlinear function. The calculations presented here are in good agreement with the experimental data within 10%. Other used by many researchers mechanical models such as an elastic rod, wormlike chain (WLC), accordion bellows, or an elastic core wrapped with rigid wires do not show the possible variance nonlinearity of thermomechanical DNA molecular length fluctuations. We have found that the nonlinear variance of the length fluctuations is an intrinsic property of the micro-nano-sensors with helicoidal shape. This model allows us to estimate the persistence length and twist-stretch coupling of a DNA molecule as well. It also shows the molecule's overwinding possibility at initial stretching with correct numerical representation.

Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

PubMed Central

Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

2012-01-01

X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

Unraveling DNA dynamics using atomic force microscopy.

PubMed

Suzuki, Yuki; Yoshikawa, Yuko; Yoshimura, Shige H; Yoshikawa, Kenichi; Takeyasu, Kunio

2011-01-01

The elucidation of structure-function relationships of biological samples has become important issue in post-genomic researches. In order to unveil the molecular mechanisms controlling gene regulations, it is essential to understand the interplay between fundamental DNA properties and the dynamics of the entire molecule. The wide range of applicability of atomic force microscopy (AFM) has allowed us to extract physicochemical properties of DNA and DNA-protein complexes, as well as to determine their topographical information. Here, we review how AFM techniques have been utilized to study DNA and DNA-protein complexes and what types of analyses have accelerated the understanding of the DNA dynamics. We begin by illustrating the application of AFM to investigate the fundamental feature of DNA molecules; topological transition of DNA, length dependent properties of DNA molecules, flexibility of double-stranded DNA, and capability of the formation of non-Watson-Crick base pairing. These properties of DNA are critical for the DNA folding and enzymatic reactions. The technical advancement in the time-resolution of AFM and sample preparation methods enabled visual analysis of DNA-protein interactions at sub-second time region. DNA tension-dependent enzymatic reaction and DNA looping dynamics by restriction enzymes were examined at a nanoscale in physiological environments. Contribution of physical properties of DNA to dynamics of nucleosomes and transition of the higher-order structure of reconstituted chromatin are also reviewed. Copyright © 2011 John Wiley & Sons, Inc.

Mutagenicity and clastogenicity of extracts of Helicobacter pylori detected by the Ames test and in the micronucleus test using human lymphoblastoid cells.

PubMed

Arimoto-Kobayashi, Sakae; Ohta, Kaori; Yuhara, Yuta; Ayabe, Yuka; Negishi, Tomoe; Okamoto, Keinosuke; Nakajima, Yoshihiro; Ishikawa, Takeshi; Oguma, Keiji; Otsuka, Takanao

2015-07-01

Epidemiological studies have demonstrated a close association between infection with Helicobacter pylori (H.pylori) and the development of gastric carcinoma. Chronic H.pylori infection increases the frequency of mutation in gastric epithelial cells. However, the mechanism by which infection of H.pylori leads to mutation in gastric epithelial cells is unclear. We suspected that components in H.pylori may be related to the mutagenic response associated with DNA alkylation, and could be detected with the Ames test using a more sensitive strain for alkylating agents. Our investigation revealed that an extract of H.pylori was mutagenic in the Ames test with Salmonella typhimurium YG7108, which is deficient in the DNA repair of O(6)-methylguanine. The extract of H.pylori may contain methylating or alkylating agents, which might induce O (6)-alkylguanine in DNA. Mutagenicity of the alkylating agents N-methyl-N-nitrosourea (MNU) and N-methyl-N'-nitro-N-nitrosoguanidine in the Ames test with S.typhimurium TA1535 was enhanced significantly in the presence of the extract of H.pylori. The tested extracts of H.pylori resulted in a significant induction of micronuclei in human-derived lymphoblastoid cells. Heat instability and dialysis resistance of the extracts of H.pylori suggest that the mutagenic component in the extracts of H.pylori is a heat-unstable large molecule or a heat-labile small molecule strongly attached or adsorbed to a large molecule. Proteins in the extracts of H.pylori were subsequently fractionated using ammonium sulphate precipitation. However, all fractions expressed enhancing effects toward MNU mutagenicity. These results suggest the mutagenic component is a small molecule that is absorbed into proteins in the extract of H.pylori, which resist dialysis. Continuous and chronic exposure of gastric epithelial cells to the alkylative mutagenic component from H.pylori chronically infected in the stomach might be a causal factor in the gastric carcinogenesis associated with H.pylori. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Analysis of branched DNA replication and recombination intermediates from prokaryotic cells by two-dimensional (2D) native-native agarose gel electrophoresis.

PubMed

Robinson, Nicholas P

2013-01-01

Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

SJL-1, a C-type lectin, acts as a surface defense molecule in Japanese sea cucumber, Apostichopus japonicus.

PubMed

Ono, Keisuke; Suzuki, Takuya Alan; Toyoshima, Youichi; Suzuki, Tomoya; Tsutsui, Shigeyuki; Odaka, Tomoyuki; Miyadai, Toshiaki; Nakamura, Osamu

2018-05-01

The surface defense molecules of aquatic invertebrates against infectious microorganisms have remained largely unexplored. In the present study, hemagglutinins were isolated from an extract of body surface layer of Japanese sea cucumber, Apostichopus japonicus, by affinity chromatography with fixed rabbit erythrocyte membranes. The N-terminal sequence of a 15-kDa agglutinin was almost identical with that of SJL-1, a C-type lectin formerly identified in this species. Because cDNA sequence and tissue distribution of SJL-1 have not been reported, we performed cDNA sequencing, gene expression analysis, and western blotting and immunohistochemical evaluation with anti-recombinant SJL-1 (rSJL-1) antibodies. The hemagglutinin gene was transcribed mainly in the integument, tentacles, and respiratory tree. Western blotting revealed that SJL-I is present in a body surface rinse, indicating that SJL-1 is secreted onto the body surface. SJL-1-positive cells scattered beneath the outermost layer of the integument were detected by immunohistochemistry. Furthermore, rSJL-1 agglutinated Gram-positive and Gram-negative bacteria, and yeast. These results indicate that SJL-1 acts as a surface defense molecule in A. japonicus. Copyright © 2018 Elsevier Ltd. All rights reserved.

Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

PubMed Central

Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

2008-01-01

Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

DNA Structure and Supercoiling: Ribbons and a Yo-Yo Model

ERIC Educational Resources Information Center

Van Horn, J. David

2011-01-01

The double-helical structure of DNA is a pop cultural icon. Images of the DNA molecule appear in newspapers, popular journals, and advertisements. In addition to scientific instrument sales, the aura surrounding the central molecule of life has been used to sell everything from perfume to beverages and is the inspiration of items ranging from…

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

PubMed

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

PubMed

Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

2014-04-01

Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

DNA-based construction at the nanoscale: emerging trends and applications

NASA Astrophysics Data System (ADS)

Lourdu Xavier, P.; Chandrasekaran, Arun Richard

2018-02-01

The field of structural DNA nanotechnology has evolved remarkably—from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes—in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.

Pros and cons of methylation-based enrichment methods for ancient DNA.

PubMed

Seguin-Orlando, Andaine; Gamba, Cristina; Der Sarkissian, Clio; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D; Lopez, Patricio; McDonald, H Gregory; Scott, Eric; Tikhonov, Alexei; Stafford, Thomas W; Alfarhan, Ahmed H; Alquraishi, Saleh A; Al-Rasheid, Khaled A S; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

2015-07-02

The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions.

Pros and cons of methylation-based enrichment methods for ancient DNA

PubMed Central

Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

2015-01-01

The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828

AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.

PubMed

Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard

2018-03-12

The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA-based construction at the nanoscale: emerging trends and applications.

PubMed

Xavier, P Lourdu; Chandrasekaran, Arun Richard

2018-02-09

The field of structural DNA nanotechnology has evolved remarkably-from the creation of artificial immobile junctions to the recent DNA-protein hybrid nanoscale shapes-in a span of about 35 years. It is now possible to create complex DNA-based nanoscale shapes and large hierarchical assemblies with greater stability and predictability, thanks to the development of computational tools and advances in experimental techniques. Although it started with the original goal of DNA-assisted structure determination of difficult-to-crystallize molecules, DNA nanotechnology has found its applications in a myriad of fields. In this review, we cover some of the basic and emerging assembly principles: hybridization, base stacking/shape complementarity, and protein-mediated formation of nanoscale structures. We also review various applications of DNA nanostructures, with special emphasis on some of the biophysical applications that have been reported in recent years. In the outlook, we discuss further improvements in the assembly of such structures, and explore possible future applications involving super-resolved fluorescence, single-particle cryo-electron (cryo-EM) and x-ray free electron laser (XFEL) nanoscopic imaging techniques, and in creating new synergistic designer materials.

fM to aM nucleic acid amplification for molecular diagnostics in a non-stick-coated metal microfluidic bioreactor

PubMed Central

Huang, Guoliang; Huang, Qin; Ma, Li; Luo, Xianbo; Pang, Biao; Zhang, Zhixin; Wang, Ruliang; Zhang, Junqi; Li, Qi; Fu, Rongxin; Ye, Jiancheng

2014-01-01

A sensitive DNA isothermal amplification method for the detection of DNA at fM to aM concentrations for pathogen identification was developed using a non-stick-coated metal microfluidic bioreactor. A portable confocal optical detector was utilized to monitor the DNA amplification in micro- to nanoliter reaction assays in real-time, with fluorescence collection near the optical diffraction limit. The non-stick-coated metal microfluidic bioreactor, with a surface contact angle of 103°, was largely inert to bio-molecules, and DNA amplification could be performed in a minimum reaction volume of 40 nL. The isothermal nucleic acid amplification for Mycoplasma pneumoniae identification in the non-stick-coated microfluidic bioreactor could be performed at a minimum DNA template concentration of 1.3 aM, and a detection limit of three copies of genomic DNA was obtained. This microfluidic bioreactor offers a promising clinically relevant pathogen molecular diagnostic method via the amplification of targets from only a few copies of genomic DNA from a single bacterium. PMID:25475544

A pliable electroporation patch (ep-Patch) for efficient delivery of nucleic acid molecules into animal tissues with irregular surface shapes.

PubMed

Wei, Zewen; Huang, Yuanyu; Zhao, Deyao; Hu, Zhiyuan; Li, Zhihong; Liang, Zicai

2015-01-05

Delivery of nucleic acids into animal tissues by electroporation is an appealing approach for various types of gene therapy, but efficiency of existing methodsis not satisfactory. Here we present the validation of novel electroporation patch (ep-Patch) for efficient delivery of DNA and siRNA into mouse tissues. Using micromachining technology, closely spaced gold electrodes were made on the pliable parylene substrate to form a patch-like electroporation metrics. It enabled large coverage of the target tissues and close surface contact between the tissues and electrodes, thus providing a uniform electric field to deliver nucleic acids into tissues, even beneath intact skin. Using this ep-Patch for efficiently delivery of both DNA and siRNA, non-invasive electroporation of healthy mouse muscle tissue was successfully achieved. Delivery of these nucleic acids was performed to intact tumors with satisfactory results. Silencing of tumor genes using the ep-Patch was also demonstrated on mice. This pliable electroporation patch method constitutes a novel way of in vivo delivery of siRNA and DNA to certain tissues or organs to circumvent the disadvantages of existing methodologies for in vivo delivery of nucleic acid molecules.

Evidence of protein-free homology recognition in magnetic bead force-extension experiments

NASA Astrophysics Data System (ADS)

O'Lee, D. J.; Danilowicz, C.; Rochester, C.; Kornyshev, A. A.; Prentiss, M.

2016-07-01

Earlier theoretical studies have proposed that the homology-dependent pairing of large tracts of dsDNA may be due to physical interactions between homologous regions. Such interactions could contribute to the sequence-dependent pairing of chromosome regions that may occur in the presence or the absence of double-strand breaks. Several experiments have indicated the recognition of homologous sequences in pure electrolytic solutions without proteins. Here, we report single-molecule force experiments with a designed 60 kb long dsDNA construct; one end attached to a solid surface and the other end to a magnetic bead. The 60 kb constructs contain two 10 kb long homologous tracts oriented head to head, so that their sequences match if the two tracts fold on each other. The distance between the bead and the surface is measured as a function of the force applied to the bead. At low forces, the construct molecules extend substantially less than normal, control dsDNA, indicating the existence of preferential interaction between the homologous regions. The force increase causes no abrupt but continuous unfolding of the paired homologous regions. Simple semi-phenomenological models of the unfolding mechanics are proposed, and their predictions are compared with the data.

Organization of 'nanocrystal molecules' using DNA

NASA Astrophysics Data System (ADS)

Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.

1996-08-01

PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

Rapid ultrasensitive single particle surface-enhanced Raman spectroscopy using metallic nanopores.

PubMed

Cecchini, Michael P; Wiener, Aeneas; Turek, Vladimir A; Chon, Hyangh; Lee, Sangyeop; Ivanov, Aleksandar P; McComb, David W; Choo, Jaebum; Albrecht, Tim; Maier, Stefan A; Edel, Joshua B

2013-10-09

Nanopore sensors embedded within thin dielectric membranes have been gaining significant interest due to their single molecule sensitivity and compatibility of detecting a large range of analytes, from DNA and proteins, to small molecules and particles. Building on this concept we utilize a metallic Au solid-state membrane to translocate and rapidly detect single Au nanoparticles (NPs) functionalized with 589 dye molecules using surface-enhanced resonance Raman spectroscopy (SERRS). We show that, due to the plasmonic coupling between the Au metallic nanopore surface and the NP, signal intensities are enhanced when probing analyte molecules bound to the NP surface. Although not single molecule, this nanopore sensing scheme benefits from the ability of SERRS to provide rich vibrational information on the analyte, improving on current nanopore-based electrical and optical detection techniques. We show that the full vibrational spectrum of the analyte can be detected with ultrahigh spectral sensitivity and a rapid temporal resolution of 880 μs.

Small molecules enhance CRISPR genome editing in pluripotent stem cells.

PubMed

Yu, Chen; Liu, Yanxia; Ma, Tianhua; Liu, Kai; Xu, Shaohua; Zhang, Yu; Liu, Honglei; La Russa, Marie; Xie, Min; Ding, Sheng; Qi, Lei S

2015-02-05

The bacterial CRISPR-Cas9 system has emerged as an effective tool for sequence-specific gene knockout through non-homologous end joining (NHEJ), but it remains inefficient for precise editing of genome sequences. Here we develop a reporter-based screening approach for high-throughput identification of chemical compounds that can modulate precise genome editing through homology-directed repair (HDR). Using our screening method, we have identified small molecules that can enhance CRISPR-mediated HDR efficiency, 3-fold for large fragment insertions and 9-fold for point mutations. Interestingly, we have also observed that a small molecule that inhibits HDR can enhance frame shift insertion and deletion (indel) mutations mediated by NHEJ. The identified small molecules function robustly in diverse cell types with minimal toxicity. The use of small molecules provides a simple and effective strategy to enhance precise genome engineering applications and facilitates the study of DNA repair mechanisms in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

An introduction to the mechanics of DNA.

PubMed

Travers, A A; Thompson, J M T

2004-07-15

This article gives an overview of recent research on the mechanical properties and spatial deformations of the DNA molecule. Globally the molecule behaves like a uniform elastic rod, and its twisting and writhing govern its compaction and packaging within a cell. Meanwhile high mechanical stresses can induce structural transitions of DNA giving, for example, a phase diagram in the space of the applied tension and torque. Locally, the mechanical properties vary according to the local sequence organization. These variations play a vital role in the biological functioning of the molecule.

Regulation of Response Regulator Autophosphorylation through Interdomain Contacts*♦

PubMed Central

Barbieri, Christopher M.; Mack, Timothy R.; Robinson, Victoria L.; Miller, Matthew T.; Stock, Ann M.

2010-01-01

DNA-binding response regulators (RRs) of the OmpR/PhoB subfamily alternate between inactive and active conformational states, with the latter having enhanced DNA-binding affinity. Phosphorylation of an aspartate residue in the receiver domain, usually via phosphotransfer from a cognate histidine kinase, stabilizes the active conformation. Many of the available structures of inactive OmpR/PhoB family proteins exhibit extensive interfaces between the N-terminal receiver and C-terminal DNA-binding domains. These interfaces invariably involve the α4-β5-α5 face of the receiver domain, the locus of the largest differences between inactive and active conformations and the surface that mediates dimerization of receiver domains in the active state. Structures of receiver domain dimers of DrrB, DrrD, and MtrA have been determined, and phosphorylation kinetics were analyzed. Analysis of phosphotransfer from small molecule phosphodonors has revealed large differences in autophosphorylation rates among OmpR/PhoB RRs. RRs with substantial domain interfaces exhibit slow rates of phosphorylation. Rates are greatly increased in isolated receiver domain constructs. Such differences are not observed between autophosphorylation rates of full-length and isolated receiver domains of a RR that lacks interdomain interfaces, and they are not observed in histidine kinase-mediated phosphotransfer. These findings suggest that domain interfaces restrict receiver domain conformational dynamics, stabilizing an inactive conformation that is catalytically incompetent for phosphotransfer from small molecule phosphodonors. Inhibition of phosphotransfer by domain interfaces provides an explanation for the observation that some RRs cannot be phosphorylated by small molecule phosphodonors in vitro and provides a potential mechanism for insulating some RRs from small molecule-mediated phosphorylation in vivo. PMID:20702407

Characterization of individual polynucleotide molecules using a membrane channel

NASA Technical Reports Server (NTRS)

Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

1996-01-01

We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

Surface Biology of DNA by Atomic Force Microscopy

NASA Astrophysics Data System (ADS)

Hansma, Helen G.

2001-10-01

The atomic force microscope operates on surfaces. Since surfaces occupy much of the space in living organisms, surface biology is a valid and valuable form of biology that has been difficult to investigate in the past owing to a lack of good technology. Atomic force microscopy (AFM) of DNA has been used to investigate DNA condensation for gene therapy, DNA mapping and sizing, and a few applications to cancer research and to nanotechnology. Some of the most exciting new applications for atomic force microscopy of DNA involve pulling on single DNA molecules to obtain measurements of single-molecule mechanics and thermodynamics.

Direct Observation of Azimuthal Correlations between DNA in Hydrated Aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kornyshev, Alexei A.; Lee, Dominic J.; Wynveen, Aaron

2005-09-30

This study revisits the classical x-ray diffraction patterns from hydrated, noncrystalline fibers originally used to establish the helical structure of DNA. We argue that changes in these diffraction patterns with DNA packing density reveal strong azimuthally dependent interactions between adjacent molecules up to {approx}40 A interaxial or {approx}20 A surface-to-surface separations. These interactions appear to force significant torsional 'straightening' of DNA and strong azimuthal alignment of nearest neighbor molecules. The results are in good agreement with the predictions of recent theoretical models relating DNA-DNA interactions to the helical symmetry of their surface charge patterns.

Coaxial atomic force microscope probes for dielectrophoresis of DNA under different buffer conditions

NASA Astrophysics Data System (ADS)

Tao, Yinglei; Kumar Wickramasinghe, H.

2017-02-01

We demonstrate a coaxial AFM nanoprobe device for dielectrophoretic (DEP) trapping of DNA molecules in Tris-EDTA (TE) and phosphate-buffered saline (PBS) buffers. The DEP properties of 20 nm polystyrene beads were studied with coaxial probes in media with different conductivities. Due to the special geometry of our DEP probe device, sufficiently high electric fields were generated at the probe end to focus DNA molecules with positive DEP. DEP trapping for both polystyrene beads and DNA molecules was quantitatively analyzed over the frequency range from 100 kHz to 50 MHz and compared with the Clausius-Mossotti theory. Finally, we discussed the negative effect of medium salinity during DEP trapping.

Probing the size of proteins with glass nanopores

NASA Astrophysics Data System (ADS)

Steinbock, L. J.; Krishnan, S.; Bulushev, R. D.; Borgeaud, S.; Blokesch, M.; Feletti, L.; Radenovic, A.

2014-11-01

Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process.Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05001k

Micromanipulation by laser microbeam and optical tweezers: from plant cells to single molecules.

PubMed

Greulich, K O; Pilarczyk, G; Hoffmann, A; Meyer Zu Hörste, G; Schäfer, B; Uhl, V; Monajembashi, S

2000-06-01

Complete manipulation by laser light allows precise and gentle treatment of plant cells, subcellular structures, and even individual DNA molecules. Recently, affordable lasers have become available for the construction of microbeams as well as for optical tweezers. This may generate new interest in these tools for plant biologists. Early experiments, reviewed in this journal, showed that laser supported microinjection of material into plant cells or tissues circumvents mechanical problems encountered in microinjection by fragile glass capillaries. Plant protoplasts could be fused with each other when under microscopical observation, and it was no major problem to generate a triple or quadruple fusion product. In the present paper we review experiments where membrane material was prepared from root hair tips and microgravity was simulated in algae. As many plant cells are transparent, it is possible to work inside living, intact cells. New experiments show that it is possible to release by optical micromanipulation, with high spatial resolutions, intracellular calcium from caged compounds and to study calcium oscillations. An example for avian cardiac tissue is given, but the technique is also suitable for plant cell research. As a more technical tool, optical tweezers can be used to spatially fix subcellular structures otherwise moving inside a cell and thus make them available for investigation with a confocal microscope even when the time for image formation is extended (for example at low fluorescence emission). A molecular biological example is the handling of chromosomes and isolated individual DNA molecules by laser microtools. For example, chromosomes can be cut along complex trajectories, not only perpendicular to their long axis. Single DNA molecules are cut by the laser microbeam and, after coupling such a molecule to a polystrene microbead, are handled in complex geometries. Here, the individual DNA molecules are made visible with a conventional fluorescence microscope by fluorescent dyes such as SYBRGreen. The cutting of a single DNA molecule by molecules of the restriction endonuclease EcoRI can be observed directly, i.e. a type of single molecule restriction analysis is possible. Finally, mechanical properties of individual DNA molecules can be observed directly.

Methods for immobilizing nucleic acids on a gel substrate

DOEpatents

Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

1999-01-01

A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

Synthesis and Characterization of DNase 1-Stabilized Gold Nanoclusters

DTIC Science & Technology

2014-10-01

Acknowledgments The authors would like to thank Victor Rodriguez Santiago for the X-ray photoelectron spectroscopy. We also acknowledge the support of the...a Materials Research Science and Engineering Center Shared Experimental Facility. The authors would also like to thank Michael Sellers and Joshua...Postdoctoral Associateship. vi INTENTIONALLY LEFT BLANK. 1 1. Introduction The labeling of biological molecules like protein or DNA has been a large

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

DOE PAGES

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; ...

2015-09-14

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Targeted drug delivery to the brain using magnetic nanoparticles.

PubMed

Thomsen, Louiza Bohn; Thomsen, Maj Schneider; Moos, Torben

2015-01-01

Brain capillary endothelial cells denote the blood-brain barrier (BBB), and conjugation of nanoparticles with antibodies that target molecules expressed by these endothelial cells may facilitate their uptake and transport into the brain. Magnetic nanoparticles can be encapsulated in liposomes and carry large molecules with therapeutic potential, for example, siRNA, cDNA and polypeptides. An additional approach to enhance the transport of magnetic nanoparticles across the BBB is the application of extracranially applied magnetic force. Stepwise targeting of magnetic nanoparticles to brain capillary endothelial cells followed by transport through the BBB using magnetic force may prove a novel mechanism for targeted therapy of macromolecules to the brain.

Adaptive resolution simulation of oligonucleotides

NASA Astrophysics Data System (ADS)

Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

2016-12-01

Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed

Gitman, A G; Graessmann, A; Loyter, A

1985-11-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed Central

Gitman, A G; Graessmann, A; Loyter, A

1985-01-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783

In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

PubMed

Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

2013-11-26

Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

Extracellular Mitochondria and Mitochondrial Components Act as Damage-Associated Molecular Pattern Molecules in the Mouse Brain.

PubMed

Wilkins, Heather M; Koppel, Scott J; Weidling, Ian W; Roy, Nairita; Ryan, Lauren N; Stanford, John A; Swerdlow, Russell H

2016-12-01

Mitochondria and mitochondrial debris are found in the brain's extracellular space, and extracellular mitochondrial components can act as damage associated molecular pattern (DAMP) molecules. To characterize the effects of potential mitochondrial DAMP molecules on neuroinflammation, we injected either isolated mitochondria or mitochondrial DNA (mtDNA) into hippocampi of C57BL/6 mice and seven days later measured markers of inflammation. Brains injected with whole mitochondria showed increased Tnfα and decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation. Some of these effects were also observed in brains injected with mtDNA (decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation), and mtDNA injection also caused several unique changes including increased CSF1R protein and AKT phosphorylation. To further establish the potential relevance of this response to Alzheimer's disease (AD), a brain disorder characterized by neurodegeneration, mitochondrial dysfunction, and neuroinflammation we also measured App mRNA, APP protein, and Aβ 1-42 levels. We found mitochondria (but not mtDNA) injections increased these parameters. Our data show that in the mouse brain extracellular mitochondria and its components can induce neuroinflammation, extracellular mtDNA or mtDNA-associated proteins can contribute to this effect, and mitochondria derived-DAMP molecules can influence AD-associated biomarkers.

Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

PubMed

Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

2018-06-05

We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

Biomedical Requirements for High Productivity Computing Systems

DTIC Science & Technology

2005-04-01

server at http://www.ncbi.nlm.nih.gov/BLAST/. There are many variants of BLAST, including: 1. BLASTN - Compares a DNA query to a DNA database. Searches ...database (3 reading frames from each strand of the DNA) searching . 13 4. TBLASTN - Compares a protein query to a DNA database, in the 6 possible...the molecular during this phase. After eliminating molecules that could not match the query , an atom-by-atom search for the molecules in conducted

Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

PubMed Central

Stellwagen, Nancy C.

2009-01-01

This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

Mitochondrial Telomeres as Molecular Markers for Identification of the Opportunistic Yeast Pathogen Candida parapsilosis

PubMed Central

Nosek, Jozef; Tomáška, L'ubomír; Ryčovská, Adriana; Fukuhara, Hiroshi

2002-01-01

Recent studies have demonstrated that a large number of organisms carry linear mitochondrial DNA molecules possessing specialized telomeric structures at their ends. Based on this specific structural feature of linear mitochondrial genomes, we have developed an approach for identification of the opportunistic yeast pathogen Candida parapsilosis. The strategy for identification of C. parapsilosis strains is based on PCR amplification of specific DNA sequences derived from the mitochondrial telomere region. This assay is complemented by immunodetection of a protein component of mitochondrial telomeres. The results demonstrate that mitochondrial telomeres represent specific molecular markers with potential applications in yeast diagnostics and taxonomy. PMID:11923346

The force-dependent mechanism of DnaK-mediated mechanical folding

PubMed Central

Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi

2018-01-01

It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

NASA Astrophysics Data System (ADS)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Model of biological quantum logic in DNA.

PubMed

Mihelic, F Matthew

2013-08-02

The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.

Understanding the mechanism of DNA deactivation in ion therapy of cancer cells: hydrogen peroxide action*

NASA Astrophysics Data System (ADS)

Piatnytskyi, Dmytro V.; Zdorevskyi, Oleksiy O.; Perepelytsya, Sergiy M.; Volkov, Sergey N.

2015-11-01

Changes in the medium of biological cells under ion beam irradiation has been considered as a possible cause of cell function disruption in the living body. The interaction of hydrogen peroxide, a long-lived molecular product of water radiolysis, with active sites of DNA macromolecule was studied, and the formation of stable DNA-peroxide complexes was considered. The phosphate groups of the macromolecule backbone were picked out among the atomic groups of DNA double helix as a probable target for interaction with hydrogen peroxide molecules. Complexes consisting of combinations including: the DNA phosphate group, H2O2 and H2O molecules, and Na+ counterion, were considered. The counterions have been taken into consideration insofar as under the natural conditions they neutralise DNA sugar-phosphate backbone. The energy of the complexes have been determined by considering the electrostatic and the Van der Waals interactions within the framework of atom-atom potential functions. As a result, the stability of various configurations of molecular complexes was estimated. It was shown that DNA phosphate groups and counterions can form stable complexes with hydrogen peroxide molecules, which are as stable as the complexes with water molecules. It has been demonstrated that the formation of stable complexes of H2O2-Na+-PO4- may be detected experimentally by observing specific vibrations in the low-frequency Raman spectra. The interaction of H2O2 molecule with phosphate group of the double helix backbone can disrupt DNA biological function and induce the deactivation of the cell genetic apparatus. Thus, the production of hydrogen peroxide molecules in the nucleus of living cells can be considered as an additional mechanism by which high-energy ion beams destroy tumour cells during ion beam therapy. Contribution to the Topical Issue "COST Action Nano-IBCT: Nano-scale Processes Behind Ion-Beam Cancer Therapy", edited by Andrey Solov'yov, Nigel Mason, Gustavo García, Eugene Surdutovich.

Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.

PubMed

Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan

2008-11-01

Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.

Complete Mitochondrial Genome of Eruca sativa Mill. (Garden Rocket)

PubMed Central

Yang, Qing; Chang, Shengxin; Chen, Jianmei; Hu, Maolong; Guan, Rongzhan

2014-01-01

Eruca sativa (Cruciferae family) is an ancient crop of great economic and agronomic importance. Here, the complete mitochondrial genome of Eruca sativa was sequenced and annotated. The circular molecule is 247 696 bp long, with a G+C content of 45.07%, containing 33 protein-coding genes, three rRNA genes, and 18 tRNA genes. The Eruca sativa mitochondrial genome may be divided into six master circles and four subgenomic molecules via three pairwise large repeats, resulting in a more dynamic structure of the Eruca sativa mtDNA compared with other cruciferous mitotypes. Comparison with the Brassica napus MtDNA revealed that most of the genes with known function are conserved between these two mitotypes except for the ccmFN2 and rrn18 genes, and 27 point mutations were scattered in the 14 protein-coding genes. Evolutionary relationships analysis suggested that Eruca sativa is more closely related to the Brassica species and to Raphanus sativus than to Arabidopsis thaliana. PMID:25157569

Properties of targeted preamplification in DNA and cDNA quantification.

PubMed

Andersson, Daniel; Akrap, Nina; Svec, David; Godfrey, Tony E; Kubista, Mikael; Landberg, Göran; Ståhlberg, Anders

2015-01-01

Quantification of small molecule numbers often requires preamplification to generate enough copies for accurate downstream enumerations. Here, we studied experimental parameters in targeted preamplification and their effects on downstream quantitative real-time PCR (qPCR). To evaluate different strategies, we monitored the preamplification reaction in real-time using SYBR Green detection chemistry followed by melting curve analysis. Furthermore, individual targets were evaluated by qPCR. The preamplification reaction performed best when a large number of primer pairs was included in the primer pool. In addition, preamplification efficiency, reproducibility and specificity were found to depend on the number of template molecules present, primer concentration, annealing time and annealing temperature. The amount of nonspecific PCR products could also be reduced about 1000-fold using bovine serum albumin, glycerol and formamide in the preamplification. On the basis of our findings, we provide recommendations how to perform robust and highly accurate targeted preamplification in combination with qPCR or next-generation sequencing.

Brothers in Arms

PubMed Central

Bhindi, Ravinay; Fahmy, Roger G.; Lowe, Harry C.; Chesterman, Colin N.; Dass, Crispin R.; Cairns, Murray J.; Saravolac, Edward G.; Sun, Lun-Quan; Khachigian, Levon M.

2007-01-01

The past decade has seen the rapid evolution of small-molecule gene-silencing strategies, driven largely by enhanced understanding of gene function in the pathogenesis of disease. Over this time, many genes have been targeted by specifically engineered agents from different classes of nucleic acid-based drugs in experimental models of disease to probe, dissect, and characterize further the complex processes that underpin molecular signaling. Arising from this, a number of molecules have been examined in the setting of clinical trials, and several have recently made the successful transition from the bench to the clinic, heralding an exciting era of gene-specific treatments. This is particularly important because clear inadequacies in present therapies account for significant morbidity, mortality, and cost. The broad umbrella of gene-silencing therapeutics encompasses a range of agents that include DNA enzymes, short interfering RNA, antisense oligonucleotides, decoys, ribozymes, and aptamers. This review tracks current movements in these technologies, focusing mainly on DNA enzymes and short interfering RNA, because these are poised to play an integral role in antigene therapies in the future. PMID:17717148

Quantitative analysis of single-molecule force spectroscopy on folded chromatin fibers

PubMed Central

Meng, He; Andresen, Kurt; van Noort, John

2015-01-01

Single-molecule techniques allow for picoNewton manipulation and nanometer accuracy measurements of single chromatin fibers. However, the complexity of the data, the heterogeneity of the composition of individual fibers and the relatively large fluctuations in extension of the fibers complicate a structural interpretation of such force-extension curves. Here we introduce a statistical mechanics model that quantitatively describes the extension of individual fibers in response to force on a per nucleosome basis. Four nucleosome conformations can be distinguished when pulling a chromatin fiber apart. A novel, transient conformation is introduced that coexists with single wrapped nucleosomes between 3 and 7 pN. Comparison of force-extension curves between single nucleosomes and chromatin fibers shows that embedding nucleosomes in a fiber stabilizes the nucleosome by 10 kBT. Chromatin fibers with 20- and 50-bp linker DNA follow a different unfolding pathway. These results have implications for accessibility of DNA in fully folded and partially unwrapped chromatin fibers and are vital for understanding force unfolding experiments on nucleosome arrays. PMID:25779043

Drosophila neuroglian: a member of the immunoglobulin superfamily with extensive homology to the vertebrate neural adhesion molecule L1.

PubMed

Bieber, A J; Snow, P M; Hortsch, M; Patel, N H; Jacobs, J R; Traquina, Z R; Schilling, J; Goodman, C S

1989-11-03

Drosophila neuroglian is an integral membrane glycoprotein that is expressed on a variety of cell types in the Drosophila embryo, including expression on a large subset of glial and neuronal cell bodies in the central and peripheral nervous systems and on the fasciculating axons that extend along them. Neuroglian cDNA clones were isolated by expression cloning. cDNA sequence analysis reveals that neuroglian is a member of the immunoglobulin superfamily. The extracellular portion of the protein consists of six immunoglobulin C2-type domains followed by five fibronectin type III domains. Neuroglian is closely related to the immunoglobulin-like vertebrate neural adhesion molecules and, among them, shows most extensive homology to mouse L1. Its homology to L1 and its embryonic localization suggest that neuroglian may play a role in neural and glial cell adhesion in the developing Drosophila embryo. We report here on the identification of a lethal mutation in the neuroglian gene.

Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

PubMed

Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

2017-01-01

Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

Multi-wavelength search for complex molecules in Titan's Atmosphere

NASA Astrophysics Data System (ADS)

Nixon, C. A.; Cordiner, M. A.; Greathouse, T. K.; Richter, M.; Kisiel, Z.; Irwin, P. G.; Teanby, N. A.; Kuan, Y. J.; Charnley, S. B.

2017-12-01

Titan's atmosphere is one of the most complex astrochemical environments known: the photochemistry of methane and nitrogen, induced by solar UV and Saturn magnetospheric electron impacts, creates a bonanza of organic molecules like no other place in the solar system. Cassini has unveiled the first glimpses of Titan's chemical wonderland, but many gaps remain. In particular, interpreting the mass spectra of Titan's upper atmosphere requires external knowledge, to disentangle the signature of molecules from their identical-mass brethren. Cassini infrared spectroscopy with CIRS has helped to some extent, but is also limited by low spectral resolution. Potentially to the rescue, comes high-resolution spectroscopy from the Earth at infrared and sub-millimeter wavelengths, where molecules exhibit vibrational and rotational transitions respectively. In this presentation, we describe the quest to make new, unique identifications of large molecules in Titan's atmosphere, focusing specifically on cyclic molecules including N-heterocycles. This molecular family is of high astrobiological significance, forming the basic ring structure for DNA nucleobases. We present the latest spectroscopic observations of Titan from ALMA and NASA's IRTF telescope, discussing present findings and directions for future work.

Rational design of DNA sequences for nanotechnology, microarrays and molecular computers using Eulerian graphs.

PubMed

Pancoska, Petr; Moravek, Zdenek; Moll, Ute M

2004-01-01

Nucleic acids are molecules of choice for both established and emerging nanoscale technologies. These technologies benefit from large functional densities of 'DNA processing elements' that can be readily manufactured. To achieve the desired functionality, polynucleotide sequences are currently designed by a process that involves tedious and laborious filtering of potential candidates against a series of requirements and parameters. Here, we present a complete novel methodology for the rapid rational design of large sets of DNA sequences. This method allows for the direct implementation of very complex and detailed requirements for the generated sequences, thus avoiding 'brute force' filtering. At the same time, these sequences have narrow distributions of melting temperatures. The molecular part of the design process can be done without computer assistance, using an efficient 'human engineering' approach by drawing a single blueprint graph that represents all generated sequences. Moreover, the method eliminates the necessity for extensive thermodynamic calculations. Melting temperature can be calculated only once (or not at all). In addition, the isostability of the sequences is independent of the selection of a particular set of thermodynamic parameters. Applications are presented for DNA sequence designs for microarrays, universal microarray zip sequences and electron transfer experiments.

Threading dynamics of a polymer through parallel pores: Potential applications to DNA size separation

NASA Astrophysics Data System (ADS)

Åkerman, Björn

1997-04-01

DNA orientation measurements by linear dichroism (LD) spectroscopy and single molecule imaging by fluorescence microscopy are used to investigate the effect of DNA size (71-740 kilo base pairs) and field strength E (1-5.9 V/cm) on the conformation dynamics during the field-driven threading of DNA molecules through a set of parallel pores in agarose gels, with average pore radii between 380 Å and 1400 Å. Locally relaxed but globally oriented DNA molecules are subjected to a perpendicular field, and the observed LD time profile is compared with a recent theory for the threading [D. Long and J.-L. Viovy, Phys. Rev. E 53, 803 (1996)] which assumes the same initial state. As predicted the DNA is driven by the ends into a U-form, leading to an overshoot in the LD. The overshoot-time scales as E-(1.2-1.4) as predicted, but grows more slowly with DNA size than the predicted linear dependence. For long molecules loops form initially in the threading process but are finally consumed by the ends, and the process of transfer of DNA segments, from the loops to the arms of the U, leads to a shoulder in the LD as predicted. The critical size below which loops do not form (as indicated by the LD shoulder being absent) is between 71 and 105 kbp (0.5% agarose, 5.9 V/cm), and considerably larger than predicted because in the initial state the DNA molecules are housed in gel cavities with effective pore sizes about four times larger than the average pore size. From the data, the separation of DNA by exploiting the threading dynamics in pulsed fields [D. Long et al., CR Acad. Sci. Paris, Ser. IIb 321, 239 (1995)] is shown to be feasible in principle in an agarose-based system.

Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.

PubMed

Yang, Darren; Wong, Wesley P

2018-01-01

We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.