Transformation of Escherichia coli with large DNA molecules by electroporation.
Sheng, Y; Mancino, V; Birren, B
1995-01-01
We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828
NASA Astrophysics Data System (ADS)
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules
Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.
2015-01-01
Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333
NASA Astrophysics Data System (ADS)
Vologodskii, Alexander
2016-09-01
The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.
A Single-Molecule Barcoding System using Nanoslits for DNA Analysis
NASA Astrophysics Data System (ADS)
Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.
Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels
Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon
2017-01-01
Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching
NASA Astrophysics Data System (ADS)
Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.
2007-02-01
We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).
NASA Technical Reports Server (NTRS)
Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)
1998-01-01
The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.
Deformation of DNA molecules by hydrodynamic focusing
NASA Astrophysics Data System (ADS)
Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming
2003-12-01
The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.
DNA-psoralen interaction: a single molecule experiment.
Rocha, M S; Viana, N B; Mesquita, O N
2004-11-15
By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.
Topological events in single molecules of E. coli DNA confined in nanochannels
Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han
2015-01-01
We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508
Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging
2009-01-01
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980
Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.
Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C
2010-01-19
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
NASA Astrophysics Data System (ADS)
Buyukdagli, Sahin
2017-02-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
NASA Astrophysics Data System (ADS)
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-01-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928
Visualization of DNA molecules in time during electrophoresis
NASA Technical Reports Server (NTRS)
Lubega, Seth
1991-01-01
For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.
Evaluation of genotoxicity testing of FDA approved large molecule therapeutics.
Sawant, Satin G; Fielden, Mark R; Black, Kurt A
2014-10-01
Large molecule therapeutics (MW>1000daltons) are not expected to enter the cell and thus have reduced potential to interact directly with DNA or related physiological processes. Genotoxicity studies are therefore not relevant and typically not required for large molecule therapeutic candidates. Regulatory guidance supports this approach; however there are examples of marketed large molecule therapeutics where sponsors have conducted genotoxicity studies. A retrospective analysis was performed on genotoxicity studies of United States FDA approved large molecule therapeutics since 1998 identified through the Drugs@FDA website. This information was used to provide a data-driven rationale for genotoxicity evaluations of large molecule therapeutics. Fifty-three of the 99 therapeutics identified were tested for genotoxic potential. None of the therapeutics tested showed a positive outcome in any study except the peptide glucagon (GlucaGen®) showing equivocal in vitro results, as stated in the product labeling. Scientific rationale and data from this review indicate that testing of a majority of large molecule modalities do not add value to risk assessment and support current regulatory guidance. Similarly, the data do not support testing of peptides containing only natural amino acids. Peptides containing non-natural amino acids and small molecules in conjugated products may need to be tested. Copyright © 2014 Elsevier Inc. All rights reserved.
Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V
2006-10-15
The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.
Single molecule techniques in DNA repair: A primer
Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.
2016-01-01
A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596
Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.
Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian
2016-04-15
Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.
Molecular transport through large-diameter DNA nanopores
NASA Astrophysics Data System (ADS)
Krishnan, Swati; Ziegler, Daniela; Arnaut, Vera; Martin, Thomas G.; Kapsner, Korbinian; Henneberg, Katharina; Bausch, Andreas R.; Dietz, Hendrik; Simmel, Friedrich C.
2016-09-01
DNA-based nanopores are synthetic biomolecular membrane pores, whose geometry and chemical functionality can be tuned using the tools of DNA nanotechnology, making them promising molecular devices for applications in single-molecule biosensing and synthetic biology. Here we introduce a large DNA membrane channel with an ~4 nm diameter pore, which has stable electrical properties and spontaneously inserts into flat lipid bilayer membranes. Membrane incorporation is facilitated by a large number of hydrophobic functionalizations or, alternatively, streptavidin linkages between biotinylated channels and lipids. The channel displays an Ohmic conductance of ~3 nS, consistent with its size, and allows electrically driven translocation of single-stranded and double-stranded DNA analytes. Using confocal microscopy and a dye influx assay, we demonstrate the spontaneous formation of membrane pores in giant unilamellar vesicles. Pores can be created both in an outside-in and an inside-out configuration.
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
ERIC Educational Resources Information Center
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Single-Molecule Electrical Random Resequencing of DNA and RNA
NASA Astrophysics Data System (ADS)
Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji
2012-07-01
Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.
Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules
Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian
2016-01-01
Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
Mapping DNA polymerase errors by single-molecule sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, David F.; Lu, Jenny; Chang, Seungwoo
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Mapping DNA polymerase errors by single-molecule sequencing
Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...
2016-05-16
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Single Molecule Study of Metalloregulatory Protein-DNA Interactions
NASA Astrophysics Data System (ADS)
Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng
2007-03-01
Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Torsional mechanics of DNA are regulated by small-molecule intercalation.
Celedon, Alfredo; Wirtz, Denis; Sun, Sean
2010-12-23
Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.
Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.
Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten
2006-07-01
bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.
A Modified Gibson Assembly Method for Cloning Large DNA Fragments with High GC Contents.
Li, Lei; Jiang, Weihong; Lu, Yinhua
2018-01-01
Gibson one-step, isothermal assembly method (Gibson assembly) can be used to efficiently assemble large DNA molecules by in vitro recombination involving a 5'-exonuclease, a DNA polymerase and a DNA ligase. In the past few years, this robust DNA assembly method has been widely applied to seamlessly construct genes, genetic pathways and even entire genomes. Here, we expand this method to clone large DNA fragments with high GC contents, such as antibiotic biosynthetic gene clusters from Streptomyces . Due to the low isothermal condition (50 °C) in the Gibson reaction system, the complementary overlaps with high GC contents are proposed to easily form mismatched linker pairings, which leads to low assembly efficiencies mainly due to vector self-ligation. So, we modified this classic method by the following two steps. First, a pair of universal terminal single-stranded DNA overhangs with high AT contents are added to the ends of the BAC vector. Second, two restriction enzyme sites are introduced into the respective sides of the designed overlaps to achieve the hierarchical assembly of large DNA molecules. The optimized Gibson assembly method facilitates fast acquisition of large DNA fragments with high GC contents from Streptomyces.
DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.
Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi
2017-12-06
We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.
Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C
2014-03-12
The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Functional helicoidal model of DNA molecule with elastic nonlinearity
NASA Astrophysics Data System (ADS)
Tseytlin, Y. M.
2013-06-01
We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.
NASA Astrophysics Data System (ADS)
Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón
2017-04-01
The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.
Nanopore detection of DNA molecules in crowded neutral polymer solutions
NASA Astrophysics Data System (ADS)
Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven
Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.
Single DNA molecule detection using nanopipettes and nanoparticles.
Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D
2005-02-01
Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.
Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.
Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro
2018-06-13
The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
An integrated optics microfluidic device for detecting single DNA molecules.
Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W
2007-12-01
A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.
Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K
2005-01-01
Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA
Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.
2017-01-01
Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846
Developing DNA nanotechnology using single-molecule fluorescence.
Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal
2014-06-17
CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA
Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia
1973-01-01
Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165
Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work
NASA Astrophysics Data System (ADS)
Kowalczykowski, Stephen
2013-03-01
We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.
Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.
Yadav, Hemendra; Sharma, Pulkit
2017-11-01
Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.
DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.
Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg
2014-04-15
DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target
Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy
ERIC Educational Resources Information Center
Ito, Takashi
2008-01-01
This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…
How to read and write mechanical information in DNA molecules
NASA Astrophysics Data System (ADS)
Schiessel, Helmut
In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.
DNA curtains for high-throughput single-molecule optical imaging.
Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis
2010-01-01
Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.
Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels
NASA Astrophysics Data System (ADS)
Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik
2009-03-01
We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.
Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels
NASA Astrophysics Data System (ADS)
Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik
2010-03-01
Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.
NASA Astrophysics Data System (ADS)
Stasiak, Andrzej
2016-09-01
Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.
Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation
NASA Astrophysics Data System (ADS)
Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan
2015-08-01
Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.
The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy
NASA Astrophysics Data System (ADS)
Sharipov, T. I.; Bakhtizin, R. Z.
2017-10-01
An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.
Chen, Xiang
2013-09-01
A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.
Drug-DNA interactions at single molecule level: A view with optical tweezers
NASA Astrophysics Data System (ADS)
Paramanathan, Thayaparan
Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by
Winding single-molecule double-stranded DNA on a nanometer-sized reel
You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki
2012-01-01
A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992
NASA Astrophysics Data System (ADS)
Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai
2016-07-01
The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).
Single-molecule analysis of DNA uncoiling by a type II topoisomerase
NASA Astrophysics Data System (ADS)
Strick, Terence R.; Croquette, Vincent; Bensimon, David
2000-04-01
Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haab, B.B.; Mathies, R.A.
A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less
Organization of 'nanocrystal molecules' using DNA
NASA Astrophysics Data System (ADS)
Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.
1996-08-01
PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
Single Molecule Study of DNA Organization and Recombination
NASA Astrophysics Data System (ADS)
Xiao, Botao
We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459
Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules
NASA Astrophysics Data System (ADS)
Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh
2017-05-01
We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.
Current-voltage characteristics of double stranded versus single stranded DNA molecules
NASA Astrophysics Data System (ADS)
Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.
2004-03-01
Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)
DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs
NASA Astrophysics Data System (ADS)
Golubovic, Leonardo
2005-03-01
We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.
The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule
NASA Astrophysics Data System (ADS)
Ashhadi, M.
2018-07-01
We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.
Gating electrical transport through DNA molecules that bridge between silicon nanogaps.
Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige
2012-03-21
DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012
Polymer physics experiments with single DNA molecules
NASA Astrophysics Data System (ADS)
Smith, Douglas E.
1999-11-01
Bacteriophage DNA molecules were taken as a model flexible polymer chain for the experimental study of polymer dynamics at the single molecule level. Video fluorescence microscopy was used to directly observe the conformational dynamics of fluorescently labeled molecules, optical tweezers were used to manipulate individual molecules, and micro-fabricated flow cells were used to apply controlled hydrodynamic strain to molecules. These techniques constitute a powerful new experimental approach in the study of basic polymer physics questions. I have used these techniques to study the diffusion and relaxation of isolated and entangled polymer molecules and the hydrodynamic deformation of polymers in elongational and shear flows. These studies revealed a rich, and previously unobserved, ``molecular individualism'' in the dynamical behavior of single molecules. Individual measurements on ensembles of identical molecules allowed the average conformation to be determined as well as the underlying probability distributions for molecular conformation. Scaling laws, that predict the dependence of properties on chain length and concentration, were also tested. The basic assumptions of the reptation model were directly confirmed by visualizing the dynamics of entangled chains.
A 3D-DNA Molecule Made of PlayMais
ERIC Educational Resources Information Center
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung
2013-02-18
A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Single-molecule DNA detection with an engineered MspA protein nanopore
Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.
2008-01-01
Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105
Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules
NASA Astrophysics Data System (ADS)
Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna
2017-12-01
Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
NASA Astrophysics Data System (ADS)
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
NASA Astrophysics Data System (ADS)
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Bell, Nicholas A W; Keyser, Ulrich F
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
Imaging and sizing of single DNA molecules on a mobile phone.
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2014-12-23
DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.
Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy
Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.
2016-01-01
There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†
Eoff, Robert L.; Raney, Kevin D.
2010-01-01
Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.
Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R
2018-07-01
DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50 = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.
Multiplex single-molecule interaction profiling of DNA-barcoded proteins.
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M
2014-11-27
In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.
Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio
2017-10-24
High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.
Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.
Ozsolak, Fatih
2016-01-01
With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.
Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.
Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W
2011-02-09
Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.
The Dynamics of Entangled DNA Networks using Single-Molecule Methods
NASA Astrophysics Data System (ADS)
Chapman, Cole David
Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.
Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu
2014-01-01
Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
NASA Astrophysics Data System (ADS)
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
A single molecule study of G-quadruplex and short duplex DNA structures
NASA Astrophysics Data System (ADS)
Roy, William A., Jr.
Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.
Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain
2010-04-22
+C-rich human DNA molecules, more likely results from a large-scale intrinsic curvature due to a persistent distribution of DNA curvature sites than from some increased flexibility.
Torsional stress in DNA limits collaboration among reverse gyrase molecules.
Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko
2016-04-01
Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules
NASA Astrophysics Data System (ADS)
Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan
DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
NASA Astrophysics Data System (ADS)
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.
Ghodke, Harshad; Ho, Han; van Oijen, Antoine M
2018-02-19
Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
NASA Astrophysics Data System (ADS)
Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.
2008-06-01
Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.
Decelerating and Trapping Large Polar Molecules.
Patterson, David
2016-11-18
Manipulating the motion of large polyatomic molecules, such as benzonitrile (C 6 H 5 CN), presents significant difficulties compared to the manipulation of diatomic molecules. Although recent impressive results have demonstrated manipulation, trapping, and cooling of molecules as large as CH 3 F, no general technique for trapping such molecules has been demonstrated, and cold neutral molecules larger than 5 atoms have not been trapped (M. Zeppenfeld, B. G. U. Englert, R. Glöckner, A. Prehn, M. Mielenz, C. Sommer, L. D. van Buuren, M. Motsch, G. Rempe, Nature 2012, 491, 570-573). In particular, extending Stark deceleration and electrostatic trapping to such species remains challenging. Here, we propose to combine a novel "asymmetric doublet state" Stark decelerator with recently demonstrated slow, cold, buffer-gas-cooled beams of closed-shell volatile molecules to realize a general system for decelerating and trapping samples of a broad range of volatile neutral polar prolate asymmetric top molecules. The technique is applicable to most stable volatile molecules in the 100-500 AMU range, and would be capable of producing trapped samples in a single rotational state and at a motional temperature of hundreds of mK. Such samples would immediately allow for spectroscopy of unprecedented resolution, and extensions would allow for further cooling and direct observation of slow intramolecular processes such as vibrational relaxation and Hertz-level tunneling dynamics. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Detecting single DNA molecule interactions with optical microcavities (Presentation Recording)
NASA Astrophysics Data System (ADS)
Vollmer, Frank
2015-09-01
Detecting molecules and their interactions lies at the heart of all biosensor devices, which have important applications in health, environmental monitoring and biomedicine. Achieving biosensing capability at the single molecule level is, moreover, a particularly important goal since single molecule biosensors would not only operate at the ultimate detection limit by resolving individual molecular interactions, but they could also monitor biomolecular properties which are otherwise obscured in ensemble measurements. For example, a single molecule biosensor could resolve the fleeting interaction kinetics between a molecule and its receptor, with immediate applications in clinical diagnostics. We have now developed a label-free biosensing platform that is capable of monitoring single DNA molecules and their interaction kinetics[1], hence achieving an unprecedented sensitivity in the optical domain, Figure 1. We resolve the specific contacts between complementary oligonucleotides, thereby detecting DNA strands with less than 2.4 kDa molecular weight. Furthermore we can discern strands with single nucleotide mismatches by monitoring their interaction kinetics. Our device utilizes small glass microspheres as optical transducers[1,2, 3], which are capable of increasing the number of interactions between a light beam and analyte molecules. A prism is used to couple the light beam into the microsphere. Ourr biosensing approach resolves the specific interaction kinetics between single DNA fragments. The optical transducer is assembled in a simple three-step protocol, and consists of a gold nanorod attached to a glass microsphere, where the surface of the nanorod is further modified with oligonucleotide receptors. The interaction kinetics of an oligonucleotide receptor with DNA fragments in the surrounding aqueous solution is monitored at the single molecule level[1]. The light remains confined inside the sphere where it is guided by total internal reflections along a
NASA Astrophysics Data System (ADS)
Bates, Andrew D.; Maxwell, Anthony
2016-09-01
The review, Disentangling DNA molecules[1], gives an excellent technical description of the phenomenon of topology simplification (TS) by type IIA DNA topoisomerases (topos). In the 20 years since its discovery [2], this effect has attracted a good deal of attention, probably because of its apparently magical nature, and because it seemed to offer a solution to the conundrum that all type II topos rely on ATP hydrolysis, but only bacterial DNA gyrases were known to transduce the free energy of hydrolysis into torsion (supercoiling) in the DNA. It made good sense to think that the other enzymes are using the energy to reduce the level of supercoiling, knotting, and particularly decatenation (unlinking), below equilibrium, since the key activity of the non-supercoiling topos is the removal of links between daughter chromosomes [3]. As Vologodskii discusses [1], there have been a number of theoretical models developed to explain how the local effect of a type II topo can influence the global level of knotting and catenation in large DNA molecules, and he explains how features of two of the most successful models (bent G segment and hooked juxtapositions) may be combined to explain the magnitude of the effect and overcome a kinetic problem with the hooked juxtaposition model.
Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert
2003-01-01
Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956
Cellular strategies for regulating DNA supercoiling: A single-molecule perspective
Koster, Daniel A.; Crut, Aurélien; Shuman, Stewart; Bjornsti, Mary-Ann; Dekker, Nynke H.
2010-01-01
Summary Excess entangling and twisting of cellular DNA (i.e., DNA supercoiling) are problems inherent to the helical structure of double-stranded DNA. Supercoiling affects transcription, DNA replication, and chromosomal segregation. Consequently the cell must fine-tune supercoiling to optimize these key processes. Here, we summarize how supercoiling is generated and review experimental and theoretical insights into supercoil relaxation. We distinguish between the passive dissipation of supercoils by diffusion and the active removal of supercoils by topoisomerase enzymes. We also review single-molecule studies that elucidate the timescales and mechanisms of supercoil removal. PMID:20723754
Single-molecule analysis of DNA cross-links using nanopore technology
NASA Astrophysics Data System (ADS)
Wolna, Anna H.
The alpha-hemolysin (alpha-HL) protein ion channel is a potential next-generation sequencing platform that has been extensively used to study nucleic acids at a single-molecule level. After applying a potential across a lipid bilayer, the imbedded alpha-HL allows monitoring of the duration and current levels of DNA translocation and immobilization. Because this method does not require DNA amplification prior to sequencing, all the DNA damage present in the cell at any given time will be present during the sequencing experiment. The goal of this research is to determine if these damage sites give distinguishable current levels beyond those observed for the canonical nucleobases. Because DNA cross-links are one of the most prevalent types of DNA damage occurring in vivo, the blockage current levels were determined for thymine-dimers, guanine(C8)-thymine(N3) cross-links and platinum adducts. All of these cross-links give a different blockage current level compared to the undamaged strands when immobilized in the ion channel, and they all can easily translocate across the alpha-HL channel. Additionally, the alpha-HL nanopore technique presents a unique opportunity to study the effects of DNA cross-links, such as thymine-dimers, on the secondary structure of DNA G-quadruplexes folded from the human telomere sequence. Using this single-molecule nanopore technique we can detect subtle structural differences that cannot be easily addressed using conventional methods. The human telomere plays crucial roles in maintaining genome stability. In the presence of suitable cations, the repetitive 5'-TTAGGG human telomere sequence can fold into G-quadruplexes that adopt the hybrid fold in vivo. The telomere sequence is hypersensitive to UV-induced thymine-dimer (T=T) formation, and yet the presence of thymine dimers does not cause telomere shortening. The potential structural disruption and thermodynamic stability of the T=T-containing natural telomere sequences were studied to
Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy
Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto
2011-01-01
DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016
Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu
2015-01-31
A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.
Visualizing Chemical Interaction Dynamics of Confined DNA Molecules
NASA Astrophysics Data System (ADS)
Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina
We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.
Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.
Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C
1992-07-01
A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.
Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore
NASA Technical Reports Server (NTRS)
Vercoutere, Wenonah; DeGuzman, Veronica
2003-01-01
The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.
DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments
NASA Astrophysics Data System (ADS)
Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.
2012-02-01
We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.
Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.
Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M
2002-06-25
A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.
McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit
2016-01-01
We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808
Analysis of DNA interactions using single-molecule force spectroscopy.
Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert
2013-06-01
Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.
Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.
Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya
2018-06-04
The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H
2007-03-01
Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.
Large-scale preparation of plasmid DNA.
Heilig, J S; Elbing, K L; Brent, R
2001-05-01
Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.
Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya
2018-02-07
Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.
Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method
NASA Astrophysics Data System (ADS)
Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.
1997-11-01
We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.
Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki
2013-04-01
Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki
2015-04-01
Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.
Single-Molecule Encoders for Tracking Motor Proteins on DNA
NASA Astrophysics Data System (ADS)
Lipman, Everett A.
2012-02-01
Devices such as inkjet printers and disk drives track position and velocity using optical encoders, which produce periodic signals precisely synchronized with linear or rotational motion. We have implemented this technique at the nanometer scale by labeling DNA with regularly spaced fluorescent dyes. The resulting molecular encoders can be used in several ways for high-resolution continuous tracking of individual motor proteins. These measurements do not require mechanical coupling to macroscopic instrumentation, are automatically calibrated by the underlying structure of DNA, and depend on signal periodicity rather than absolute level. I will describe the synthesis of single-molecule encoders, data from and modeling of experiments on a helicase and a DNA polymerase, and some ideas for future work.
Did the Pre-RNA World Rest Upon DNA Molecules?
NASA Technical Reports Server (NTRS)
Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.
2004-01-01
The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.
Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip
2014-04-01
Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.
Interaction of cationic surfactants with DNA: a single-molecule study
Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin
2008-01-01
The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.
Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis
2017-12-01
Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.
Site-directed DNA crosslinking of large multisubunit protein-DNA complexes.
Persinger, Jim; Bartholomew, Blaine
2009-01-01
Several methods have been developed to site-specifically incorporate photoreactive nucleotide analogs into DNA for the purpose of identifying the proteins and their domains that are in contact with particular regions of DNA. The synthesis of several deoxynucleotide analogs that have a photoreactive group tethered to the nucleotide base and the incorporation of these analogs into DNA are described. In a second approach, oligonucleotide with a photoreactive group attached to the phosphate backbone is chemically synthesized. The photoreactive oligonucleotide is then enzymatically incorporated into DNA by annealing it to a complementary DNA template and extending with DNA polymerase. Both approaches have been effectively used to map protein-DNA interactions in large multisubunit complexes such as the eukaryotic transcription or ATP-dependent chromatin remodeling complexes. Not only do these techniques map the binding sites of the various subunits in these complexes, but when coupled with peptide mapping also determine the protein domain that is in close proximity to the different DNA sites. The strength of these techniques is the ability to scan a large number of potential sites by making combinations of different DNA probes and is facilitated by using an immobilized DNA template for synthesis.
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph
2016-05-01
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Yan, Jie
2016-09-01
In this article [1] Dr. Vologodskii presents a comprehensive discussion on the mechanisms by which the type II topoisomerases unknot/disentangle DNA molecules. It is motivated by a mysterious capability of the nanometer-size enzymes to keep the steady-state probability of DNA entanglement/knot almost two orders of magnitude below that expected from thermal equilibrium [2-5]. In spite of obvious functional advantages of the enzymes, it raises a question regarding how such high efficiency could be achieved. The off-equilibrium steady state distribution of DNA topology is powered by ATP consumption. However, it remains unclear how this energy is utilized to bias the distribution toward disentangled/unknotted topological states of DNA.
NASA Astrophysics Data System (ADS)
Zhang, Yuning; Reisner, Walter
2012-02-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.
Development of a reference material of a single DNA molecule for the quality control of PCR testing.
Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi
2014-09-02
We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires
Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu
2014-01-01
Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp–166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules. PMID:24918865
Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires
NASA Astrophysics Data System (ADS)
Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu
2014-06-01
Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp-166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules.
A lab-on-chip for biothreat detection using single-molecule DNA mapping.
Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf
2011-03-07
Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.
Single-molecule comparison of DNA Pol I activity with native and analog nucleotides
NASA Astrophysics Data System (ADS)
Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip
2014-03-01
DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.
Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William
2013-01-01
We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.
Diffusion of isolated DNA molecules: dependence on length and topology.
Robertson, Rae M; Laib, Stephan; Smith, Douglas E
2006-05-09
The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.
Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases
Charvin, G.; Bensimon, D.; Croquette, V.
2003-01-01
Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541
Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari
2012-12-01
To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.
A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit
DOE Office of Scientific and Technical Information (OSTI.GOV)
T Wang; R Sha; J Birktoft
2011-12-31
We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.
Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.
2016-01-01
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011
Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G
2016-06-24
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less
Conformational transitions in DNA polymerase I revealed by single-molecule FRET
Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.
2010-01-01
The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Large scale study of multiple-molecule queries
2009-01-01
Background In ligand-based screening, as well as in other chemoinformatics applications, one seeks to effectively search large repositories of molecules in order to retrieve molecules that are similar typically to a single molecule lead. However, in some case, multiple molecules from the same family are available to seed the query and search for other members of the same family. Multiple-molecule query methods have been less studied than single-molecule query methods. Furthermore, the previous studies have relied on proprietary data and sometimes have not used proper cross-validation methods to assess the results. In contrast, here we develop and compare multiple-molecule query methods using several large publicly available data sets and background. We also create a framework based on a strict cross-validation protocol to allow unbiased benchmarking for direct comparison in future studies across several performance metrics. Results Fourteen different multiple-molecule query methods were defined and benchmarked using: (1) 41 publicly available data sets of related molecules with similar biological activity; and (2) publicly available background data sets consisting of up to 175,000 molecules randomly extracted from the ChemDB database and other sources. Eight of the fourteen methods were parameter free, and six of them fit one or two free parameters to the data using a careful cross-validation protocol. All the methods were assessed and compared for their ability to retrieve members of the same family against the background data set by using several performance metrics including the Area Under the Accumulation Curve (AUAC), Area Under the Curve (AUC), F1-measure, and BEDROC metrics. Consistent with the previous literature, the best parameter-free methods are the MAX-SIM and MIN-RANK methods, which score a molecule to a family by the maximum similarity, or minimum ranking, obtained across the family. One new parameterized method introduced in this study and two
DNA origami based Au-Ag-core-shell nanoparticle dimers with single-molecule SERS sensitivity
NASA Astrophysics Data System (ADS)
Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.; Bald, I.
2016-03-01
DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled.DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.
Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai
2018-01-09
Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Design, synthesis and selection of DNA-encoded small-molecule libraries.
Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A
2009-09-01
Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.
Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics
Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.
2014-01-01
Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254
DNA Molecules in Microfluidic Oscillatory Flow
Chen, Y.-L.; Graham, M.D.; de Pablo, J.J.; Jo, K.; Schwartz, D.C.
2008-01-01
The conformation and dynamics of a single DNA molecule undergoing oscillatory pressure-driven flow in microfluidic channels is studied using Brownian dynamics simulations, accounting for hydrodynamic interactions between segments in the bulk and between the chain and the walls. Oscillatory flow provides a scenario under which the polymers may remain in the channel for an indefinite amount of time as they are stretched and migrate away from the channel walls. We show that by controlling the chain length, flow rate and oscillatory flow frequency, we are able to manipulate the chain extension and the chain migration from the channel walls. The chain stretch and the chain depletion layer thickness near the wall are found to increase as the Weissenberg number increases and as the oscillatory frequency decreases. PMID:19057656
Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang
2018-06-05
We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
NASA Astrophysics Data System (ADS)
Kingsland, Addie
DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.
Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A
2016-05-01
The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright
van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin
2009-09-21
Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.
Zhang, Hui; Guo, Peixuan
2014-05-15
Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.
Structure of large dsDNA viruses
Klose, Thomas; Rossmann, Michael G.
2015-01-01
Nucleocytoplasmic large dsDNA viruses (NCLDVs) encompass an ever-increasing group of large eukaryotic viruses, infecting a wide variety of organisms. The set of core genes shared by all these viruses includes a major capsid protein with a double jelly-roll fold forming an icosahedral capsid, which surrounds a double layer membrane that contains the viral genome. Furthermore, some of these viruses, such as the members of the Mimiviridae and Phycodnaviridae have a unique vertex that is used during infection to transport DNA into the host. PMID:25003382
Random access in large-scale DNA data storage.
Organick, Lee; Ang, Siena Dumas; Chen, Yuan-Jyue; Lopez, Randolph; Yekhanin, Sergey; Makarychev, Konstantin; Racz, Miklos Z; Kamath, Govinda; Gopalan, Parikshit; Nguyen, Bichlien; Takahashi, Christopher N; Newman, Sharon; Parker, Hsing-Yeh; Rashtchian, Cyrus; Stewart, Kendall; Gupta, Gagan; Carlson, Robert; Mulligan, John; Carmean, Douglas; Seelig, Georg; Ceze, Luis; Strauss, Karin
2018-03-01
Synthetic DNA is durable and can encode digital data with high density, making it an attractive medium for data storage. However, recovering stored data on a large-scale currently requires all the DNA in a pool to be sequenced, even if only a subset of the information needs to be extracted. Here, we encode and store 35 distinct files (over 200 MB of data), in more than 13 million DNA oligonucleotides, and show that we can recover each file individually and with no errors, using a random access approach. We design and validate a large library of primers that enable individual recovery of all files stored within the DNA. We also develop an algorithm that greatly reduces the sequencing read coverage required for error-free decoding by maximizing information from all sequence reads. These advances demonstrate a viable, large-scale system for DNA data storage and retrieval.
Biophysics of protein-DNA interactions and chromosome organization
Marko, John F.
2014-01-01
The function of DNA in cells depends on its interactions with protein molecules, which recognize and act on base sequence patterns along the double helix. These notes aim to introduce basic polymer physics of DNA molecules, biophysics of protein-DNA interactions and their study in single-DNA experiments, and some aspects of large-scale chromosome structure. Mechanisms for control of chromosome topology will also be discussed. PMID:25419039
Interaction of HIV-1 Gag protein components with single DNA molecules
NASA Astrophysics Data System (ADS)
Cruceanu, Margareta; Gorelick, Robert J.; Williams, Mark C.
2003-03-01
The Gag protein of the HIV-1 retrovirus is cleaved into three major proteins as part of viral maturation: nucleocapsid (NC), capsid, and matrix. NC is the first of these proteins to be cleaved, and it is cleaved in three stages into NCp15, followed by NCp9, and finally NCp7. In this study, we use optical tweezers to investigate the capability of these NC proteins to alter the helix-coil transition of single DNA molecules. We have previously shown that the capability to alter the DNA helix-coil transition is an excellent probe of the nucleic acid chaperone activity of NC proteins, in which the secondary structure of nucleic acids is rearranged to facilitate reverse transcription. By examining the capability of NCp15, NCp9, and NCp7 to alter DNA stretching, the current studies will test the role of proteolytic cleavage of Gag in regulating the nucleic acid chaperone activity of NC. Whereas binding studies suggest that NCp9 and NCp15 bind more strongly to DNA than NCp7, our DNA stretching results indicate that these proteins all have similar effects on DNA stretching.
Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin
2017-01-01
Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341
NASA Astrophysics Data System (ADS)
Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi
2018-06-01
It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.
Small-molecule inhibitors of APE1 DNA repair function: an overview.
Al-Safi, Rasha I; Odde, Srinivas; Shabaik, Yumna; Neamati, Nouri
2012-01-01
APE1 is a multifaceted protein that orchestrates multiple activities in the cell, one of which is the preservation of genomic integrity; a vital process that takes place in the context of the base excision repair (BER) pathway. Studies have implicated APE1 in rendering cancerous cells less vulnerable to the effects of DNA-damaging agents that are commonly used for the treatment of cancer. Furthermore, suppression of APE1 expression in cancer cell lines is accompanied by the potentiation of the activity of cytotoxic agents. As a result, major efforts have been directed towards the identification of small-molecule inhibitors of this DNA-repair enzyme. Herein, we review all patented small-molecule APE1 inhibitors reported prior to 2011. Unfortunately, the potency and selectivity of many of the reported inhibitors were not disclosed by the original authors, and at present it is unclear if APE1 is a bona fide target for many of the purported inhibitors. Moreover, cellular activity and toxicity of many inhibitors remain to be established. Since this is the first comprehensive review of small molecule APE1 inhibitors, we present all compounds reported to inhibit APE1 activity with an IC50 value ≤ 25 μM. Efforts towards a careful validation and optimization of these compounds are warranted. Furthermore, we explore potential allosteric drug-binding sites on the protein as an alternative approach for modulating the activity of this multifunctional protein. In addition, we give an overview of APE2, as well as other APE1 homologues in some disease-causing pathogens. Finally, given the universal importance of DNA repair, as well as the considerable conservation of repair proteins across all living organisms, we propose targeting the AP endonuclease activity of pathogens by the compounds discussed in this review, thereby expanding their therapeutic potential and application.
Simoncelli, Sabrina; Roller, Eva-Maria; Urban, Patrick; Schreiber, Robert; Turberfield, Andrew J; Liedl, Tim; Lohmüller, Theobald
2016-11-22
DNA origami is a powerful approach for assembling plasmonic nanoparticle dimers and Raman dyes with high yields and excellent positioning control. Here we show how optothermal-induced shrinking of a DNA origami template can be employed to control the gap sizes between two 40 nm gold nanoparticles in a range from 1 to 2 nm. The high field confinement achieved with this optothermal approach was demonstrated by detection of surface-enhanced Raman spectroscopy (SERS) signals from single molecules that are precisely placed within the DNA origami template that spans the nanoparticle gap. By comparing the SERS intensity with respect to the field enhancement in the plasmonic hot-spot region, we found good agreement between measurement and theory. Our straightforward approach for the fabrication of addressable plasmonic nanosensors by DNA origami demonstrates a path toward future sensing applications with single-molecule resolution.
Protein dynamics during presynaptic complex assembly on individual ssDNA molecules
Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.
2014-01-01
Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049
Paximadis, M; Rey, M E
2001-12-01
The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less
Directed self-organization of single DNA molecules in a nanoslit via embedded nanopit arrays
Reisner, Walter; Larsen, Niels B.; Flyvbjerg, Henrik; Tegenfeldt, Jonas O.; Kristensen, Anders
2009-01-01
We show that arrays of nanopit structures etched in a nanoslit can control the positioning and conformation of single DNA molecules in nanofluidic devices. By adjusting the spacing, organization and placement of the nanopits it is possible to immobilize DNA at predetermined regions of a device without additional chemical modification and achieve a high degree of control over local DNA conformation. DNA can be extended between two nanopits and in closely spaced arrays will self-assemble into “connect-the-dots” conformations consisting of locally pinned segments joined by fluctuating linkers. These results have broad implications for nanotechnology fields that require methods for the nanoscale positioning and manipulation of DNA. PMID:19122138
Incorporation of large guest molecules into liposomes via chemical reactions in lipid membranes.
Tsuchiya, Yuki; Sugikawa, Kouta; Ueda, Masafumi; Ikeda, Atsushi
2017-02-22
The incorporation of hydrophobic guest molecules into lipid membranes by the exchange of the guest molecule from a cyclodextrin (CDx) complex to a liposome is limited to guest molecules that can be included in CDxs. To solve this problem, large guest molecules were incorporated into liposomes by chemical reactions of guest molecules in lipid membranes. Stable lipid-membrane-incorporated fullerene derivatives with large substituent(s) were prepared by Diels-Alder reactions in lipid membranes.
Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.
Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D
2007-12-15
The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.
Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.
Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J
2003-10-01
Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.
Large magnetoresistance in Fe3O4/molecule nanoparticles
NASA Astrophysics Data System (ADS)
Wang, S.; Yue, F. J.; Lin, L.; Shi, Y. J.; Wu, D.
2010-08-01
In this work, we successfully fabricate Fe3O4 nanoparticles self-assembled with molecules to explore a new approach of studying the molecular spintronics. Fourier transform infrared spectroscopy measurements indicate that one monolayer molecules chemically bonds to the Fe3O4 nanoparticles and the physically absorbed molecules do not exist in the samples. The magnetoresistance (MR) of molecule fully coated ~10 nm size nanoparticles is up to 7.3% at room temperature and 17.5% at 115 K under a field of 5.8 kOe. And the MR ratio is more than two times larger than that of pure Fe3O4 nanoparticles. This enhanced MR is likely arising from weak spin scattering while carriers transport through the molecules. Moreover, a very large low field magnetoresistance is also observed with ~500nm ferromagnetic Fe3O4 nanoparticles coated with acetic acid molecules. Those features open a door for the development of future spin-based molecular electronics.
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
New Large Interstellar Molecules Detected with the GBT
NASA Technical Reports Server (NTRS)
Hollis, Jan M.
2005-01-01
At present, more than 135 different molecules have been identified in interstellar clouds. The newest instrument in the interstellar molecule search arsenal is the recently commissioned Green Bank Telescope (GBT). In 2004, the large aldehydes propenal (CH2CHCHO) and propanal (CH3CH2CHO) were the first new interstellar molecules discovered with the GBT. At the same time, the GBT was used to observe interstellar glycolaldehyde (CH2OHCHO), which is the simplest possible aldehyde sugar; interstellar ethylene glycol (HOCH2CH2OH), which is the sugar alcohol of glycolaldehyde; and interstellar methylcyanodiacetylene (CH3C5N). These new GBT observations suggest that successive atomic addition reactions are common in the formation of larger related species. The observations will be presented and discussed.
Two distinct overstretched DNA structures revealed by single-molecule thermodynamics measurements
Zhang, Xinghua; Chen, Hu; Fu, Hongxia; Doyle, Patrick S.; Yan, Jie
2012-01-01
Double-stranded DNA is a dynamic molecule whose structure can change depending on conditions. While there is consensus in the literature about many structures DNA can have, the state of highly-stretched DNA is still not clear. Several groups have shown that DNA in the torsion-unconstrained B-form undergoes an “overstretching” transition at a stretching force of around 65 pN, which leads to approximately 1.7-fold elongation of the DNA contour length. Recent experiments have revealed that two distinct structural transitions are involved in the overstretching process: (i) a hysteretic “peeling” off one strand from its complementary strand, and (ii) a nonhysteretic transition that leads to an undetermined DNA structure. We report the first simultaneous determination of the entropy (ΔS) and enthalpy changes (ΔH) pertaining to these respective transitions. For the hysteretic peeling transition, we determined ΔS ∼ 20 cal/(K.mol) and ΔH ∼ 7 kcal/mol. In the case of the nonhysteretic transition, ΔS ∼ -3 cal/(K.mol) and ΔH ∼ 1 kcal/mol. Furthermore, the response of the transition force to salt concentration implies that the two DNA strands are spatially separated after the hysteretic peeling transition. In contrast, the corresponding response after the nonhysteretic transition indicated that the strands remained in close proximity. The selection between the two transitions depends on DNA base-pair stability, and it can be illustrated by a multidimensional phase diagram. Our results provide important insights into the thermodynamics of DNA overstretching and conformational structures of overstretched DNA that may play an important role in vivo. PMID:22532662
Static and Dynamic Properties of DNA Confined in Nanochannels
NASA Astrophysics Data System (ADS)
Gupta, Damini
Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain
May the Best Molecule Win: Competition ESI Mass Spectrometry
Laughlin, Sarah; Wilson, W. David
2015-01-01
Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262
NASA Astrophysics Data System (ADS)
Herold, Christoph; Schwille, Petra; Petrov, Eugene P.
2016-02-01
We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.
Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun
2017-11-01
The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.
Single molecule analysis of Trypanosoma brucei DNA replication dynamics
Calderano, Simone Guedes; Drosopoulos, William C.; Quaresma, Marina Mônaco; Marques, Catarina A.; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L.; Elias, Maria Carolina
2015-01-01
Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5′ extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. PMID:25690894
Multiplex single-molecule interaction profiling of DNA barcoded proteins
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.
2014-01-01
In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978
DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.
Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur
2009-12-24
Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.
Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging
Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid
2015-01-01
The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093
Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.
Xue, J; Feng, Y
2018-06-01
Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.
Molecular traffic jams on DNA.
Finkelstein, Ilya J; Greene, Eric C
2013-01-01
All aspects of DNA metabolism-including transcription, replication, and repair-involve motor enzymes that move along genomic DNA. These processes must all take place on chromosomes that are occupied by a large number of other proteins. However, very little is known regarding how nucleic acid motor proteins move along the crowded DNA substrates that are likely to exist in physiological settings. This review summarizes recent progress in understanding how DNA-binding motor proteins respond to the presence of other proteins that lie in their paths. We highlight recent single-molecule biophysical experiments aimed at addressing this question, with an emphasis placed on analyzing the single-molecule, ensemble biochemical, and in vivo data from a mechanistic perspective.
Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki
2013-01-01
DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956
Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V
2017-08-04
Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Modeling DNA methylation by analyzing the individual configurations of single molecules
Affinito, Ornella; Scala, Giovanni; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Avvedimento, Vittorio Enrico; Usiello, Alessandro; Chiariotti, Lorenzo; Cocozza, Sergio
2016-01-01
ABSTRACT DNA methylation is often analyzed by reporting the average methylation degree of each cytosine. In this study, we used a single molecule methylation analysis in order to look at the methylation conformation of individual molecules. Using D-aspartate oxidase as a model gene, we performed an in-depth methylation analysis through the developmental stages of 3 different mouse tissues (brain, lung, and gut), where this gene undergoes opposite methylation destiny. This approach allowed us to track both methylation and demethylation processes at high resolution. The complexity of these dynamics was markedly simplified by introducing the concept of methylation classes (MCs), defined as the number of methylated cytosines per molecule, irrespective of their position. The MC concept smooths the stochasticity of the system, allowing a more deterministic description. In this framework, we also propose a mathematical model based on the Markov chain. This model aims to identify the transition probability of a molecule from one MC to another during methylation and demethylation processes. The results of our model suggest that: 1) both processes are ruled by a dominant class of phenomena, namely, the gain or loss of one methyl group at a time; and 2) the probability of a single CpG site becoming methylated or demethylated depends on the methylation status of the whole molecule at that time. PMID:27748645
Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina
2018-01-01
Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion
Liu, Lei; Veerappan, Vijaykumar; Pu, Qiaosheng; Cheng, Chang; Wang, Xiayan; Lu, Liping; Allen, Randy D; Guo, Guangsheng
2014-01-07
A high-resolution, rapid, and economical hydrodynamic chromatographic (HDC) method for large DNA separations in free solution was developed using narrow (5 μm diameter), bare open capillaries. Size-based separation was achieved in a chromatographic format with larger DNA molecules being eluting faster than smaller ones. Lambda DNA Mono Cut Mix was baseline-separated with the percentage resolutions generally less than 9.0% for all DNA fragments (1.5 to 48.5 kbp) tested in this work. High efficiencies were achieved for large DNA from this chromatographic technique, and the number of theoretical plates reached 3.6 × 10(5) plates for the longest (48.5 kbp) and 3.7 × 10(5) plates for the shortest (1.5 kbp) fragments. HDC parameters and performances were also discussed. The method was further applied for fractionating large DNA fragments from real-world samples (SacII digested Arabidopsis plant bacterial artificial chromosome (BAC) DNA and PmeI digested Rice BAC DNA) to demonstrate its feasibility for BAC DNA finger printing. Rapid separation of PmeI digested Rice BAC DNA covering from 0.44 to 119.041 kbp was achieved in less than 26 min. All DNA fragments of these samples were baseline separated in narrow bare open capillaries, while the smallest fragment (0.44 kbp) was missing in pulsed-field gel electrophoresis (PFGE) separation mode. It is demonstrated that narrow bare open capillary chromatography can realize a rapid separation for a wide size range of DNA mixtures that contain both small and large DNA fragments in a single run.
Multiplexed single-molecule force spectroscopy using a centrifuge.
Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P
2016-03-17
We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.
Multiplexed single-molecule force spectroscopy using a centrifuge
Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P.
2016-01-01
We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise. PMID:26984516
Single molecule analysis of Trypanosoma brucei DNA replication dynamics.
Calderano, Simone Guedes; Drosopoulos, William C; Quaresma, Marina Mônaco; Marques, Catarina A; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L; Elias, Maria Carolina
2015-03-11
Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5' extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Cytology of DNA Replication Reveals Dynamic Plasticity of Large-Scale Chromatin Fibers.
Deng, Xiang; Zhironkina, Oxana A; Cherepanynets, Varvara D; Strelkova, Olga S; Kireev, Igor I; Belmont, Andrew S
2016-09-26
In higher eukaryotic interphase nuclei, the 100- to >1,000-fold linear compaction of chromatin is difficult to reconcile with its function as a template for transcription, replication, and repair. It is challenging to imagine how DNA and RNA polymerases with their associated molecular machinery would move along the DNA template without transient decondensation of observed large-scale chromatin "chromonema" fibers [1]. Transcription or "replication factory" models [2], in which polymerases remain fixed while DNA is reeled through, are similarly difficult to conceptualize without transient decondensation of these chromonema fibers. Here, we show how a dynamic plasticity of chromatin folding within large-scale chromatin fibers allows DNA replication to take place without significant changes in the global large-scale chromatin compaction or shape of these large-scale chromatin fibers. Time-lapse imaging of lac-operator-tagged chromosome regions shows no major change in the overall compaction of these chromosome regions during their DNA replication. Improved pulse-chase labeling of endogenous interphase chromosomes yields a model in which the global compaction and shape of large-Mbp chromatin domains remains largely invariant during DNA replication, with DNA within these domains undergoing significant movements and redistribution as they move into and then out of adjacent replication foci. In contrast to hierarchical folding models, this dynamic plasticity of large-scale chromatin organization explains how localized changes in DNA topology allow DNA replication to take place without an accompanying global unfolding of large-scale chromatin fibers while suggesting a possible mechanism for maintaining epigenetic programming of large-scale chromatin domains throughout DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.
Another expert system rule inference based on DNA molecule logic gates
NASA Astrophysics Data System (ADS)
WÄ siewicz, Piotr
2013-10-01
With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.
Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C
2018-06-01
High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non
Srinivasan, Ajay; Gold, Barry
2013-01-01
A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253
Single-molecule studies of multi-protein machines
NASA Astrophysics Data System (ADS)
van Oijen, Antoine
2010-03-01
Advances in optical imaging and molecular manipulation techniques have made it possible to observe individual enzymes and record molecular movies that provide new insight into their dynamics and reaction mechanisms. In a biological context, most of these enzymes function in concert with other enzymes in multi-protein complexes, so an important future direction will be the utilization of single-molecule techniques to unravel the orchestration of large macromolecular assemblies. Our group is developing the single-molecule tools that will make it possible to study biochemical pathways of arbitrary complexity at the single-molecule level. I will discuss results of single-molecule experiments on the replisome, the molecular machinery that is responsible for replication of DNA. We stretch individual DNA molecules and use their elastic properties to obtain dynamic information on the proteins that unwind the double helix and copy its genetic information. Furthermore, we visualize fluorescently labeled components of the replisome and thus obtain information on stochiometry and exchange kinetics. This simultaneous observation of catalytic activity and composition allows us to gain deeper insight into the structure-function relationship of the replisome.
High-throughput single-molecule telomere characterization.
McCaffrey, Jennifer; Young, Eleanor; Lassahn, Katy; Sibert, Justin; Pastor, Steven; Riethman, Harold; Xiao, Ming
2017-11-01
We have developed a novel method that enables global subtelomere and haplotype-resolved analysis of telomere lengths at the single-molecule level. An in vitro CRISPR/Cas9 RNA-directed nickase system directs the specific labeling of human (TTAGGG)n DNA tracts in genomes that have also been barcoded using a separate nickase enzyme that recognizes a 7-bp motif genome-wide. High-throughput imaging and analysis of large DNA single molecules from genomes labeled in this fashion using a nanochannel array system permits mapping through subtelomere repeat element (SRE) regions to unique chromosomal DNA while simultaneously measuring the (TTAGGG)n tract length at the end of each large telomere-terminal DNA segment. The methodology also permits subtelomere and haplotype-resolved analyses of SRE organization and variation, providing a window into the population dynamics and potential functions of these complex and structurally variant telomere-adjacent DNA regions. At its current stage of development, the assay can be used to identify and characterize telomere length distributions of 30-35 discrete telomeres simultaneously and accurately. The assay's utility is demonstrated using early versus late passage and senescent human diploid fibroblasts, documenting the anticipated telomere attrition on a global telomere-by-telomere basis as well as identifying subtelomere-specific biases for critically short telomeres. Similarly, we present the first global single-telomere-resolved analyses of two cancer cell lines. © 2017 McCaffrey et al.; Published by Cold Spring Harbor Laboratory Press.
Large mitochondrial DNA deletion in an infant with addison disease.
Duran, Gloria P; Martinez-Aguayo, A; Poggi, H; Lagos, M; Gutierrez, D; Harris, P R
2012-01-01
Mitochondrial diseases are a group of disorders caused by mutations in nuclear DNA or mitochondrial DNA, usually involving multiple organ systems. Primary adrenal insufficiency due to mitochondrial disease is extremely infrequent and has been reported in association with mitochondrial DNA deletion syndromes such as Kearns-Sayre syndrome. To report a 3-year-old boy with Addison disease, congenital glaucoma, chronic pancreatitis, and mitochondrial myopathy due to large mitochondrial DNA deletion. Molecular analysis of mitochondrial DNA samples obtained from peripheral blood, oral mucosa, and muscle tissue. A novel large mitochondrial DNA deletion of 7,372bp was identified involving almost all genes on the big arch of mtDNA. This case reaffirms the association of adrenal insufficiency and mitochondrial DNA deletions and presents new evidence that glaucoma is another manifestation of mitochondrial diseases. Due to the genetic and clinical heterogeneity of mitochondrial disorders, molecular analysis is crucial to confirm diagnosis and to allow accurate genetic counseling.
Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.
2014-01-01
Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872
Dynamical spin accumulation in large-spin magnetic molecules
NASA Astrophysics Data System (ADS)
Płomińska, Anna; Weymann, Ireneusz; Misiorny, Maciej
2018-01-01
The frequency-dependent transport through a nanodevice containing a large-spin magnetic molecule is studied theoretically in the Kondo regime. Specifically, the effect of magnetic anisotropy on dynamical spin accumulation is of primary interest. Such accumulation arises due to finite components of frequency-dependent conductance that are off diagonal in spin. Here, employing the Kubo formalism and the numerical renormalization group method, we demonstrate that the dynamical transport properties strongly depend on the relative orientation of spin moments in electrodes of the device, as well as on intrinsic parameters of the molecule. In particular, the effect of dynamical spin accumulation is found to be greatly affected by the type of magnetic anisotropy exhibited by the molecule, and it develops for frequencies corresponding to the Kondo temperature. For the parallel magnetic configuration of the device, the presence of dynamical spin accumulation is conditioned by the interplay of ferromagnetic-lead-induced exchange field and the Kondo correlations.
Kemmerich, Felix E; Swoboda, Marko; Kauert, Dominik J; Grieb, M Svea; Hahn, Steffen; Schwarz, Friedrich W; Seidel, Ralf; Schlierf, Michael
2016-01-13
We present a hybrid single-molecule technique combining magnetic tweezers and Förster resonance energy transfer (FRET) measurements. Through applying external forces to a paramagnetic sphere, we induce conformational changes in DNA nanostructures, which are detected in two output channels simultaneously. First, by tracking a magnetic bead with high spatial and temporal resolution, we observe overall DNA length changes along the force axis. Second, the measured FRET efficiency between two fluorescent probes monitors local conformational changes. The synchronized orthogonal readout in different observation channels will facilitate deciphering the complex mechanisms of biomolecular machines.
Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.
2012-01-01
Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984
Facilitation of the PED analysis of large molecules by using global coordinates.
Jamróz, Michał H; Ostrowski, Sławomir; Dobrowolski, Jan Cz
2015-10-05
Global coordinates have been found to be useful in the potential energy distribution (PED) analyses of the following large molecules: [13]-acene and [33]-helicene. The global coordinate is defined based on much distanced fragments of the analysed molecule, whereas so far, the coordinates used in the analysis were based on stretchings, bendings, or torsions of the adjacent atoms. It has been shown that the PED analyses performed using the global coordinate and the classical ones can lead to exactly the same PED contributions. The global coordinates may significantly improve the facility of the analysis of the vibrational spectra of large molecules. Copyright © 2015 Elsevier B.V. All rights reserved.
Rocha, M S
2015-09-01
In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.
The colibactin warhead crosslinks DNA
NASA Astrophysics Data System (ADS)
Vizcaino, Maria I.; Crawford, Jason M.
2015-05-01
Members of the human microbiota are increasingly being correlated to human health and disease states, but the majority of the underlying microbial metabolites that regulate host-microbe interactions remain largely unexplored. Select strains of Escherichia coli present in the human colon have been linked to the initiation of inflammation-induced colorectal cancer through an unknown small-molecule-mediated process. The responsible non-ribosomal peptide-polyketide hybrid pathway encodes ‘colibactin’, which belongs to a largely uncharacterized family of small molecules. Genotoxic small molecules from this pathway that are capable of initiating cancer formation have remained elusive due to their high instability. Guided by metabolomic analyses, here we employ a combination of NMR spectroscopy and bioinformatics-guided isotopic labelling studies to characterize the colibactin warhead, an unprecedented substituted spirobicyclic structure. The warhead crosslinks duplex DNA in vitro, providing direct experimental evidence for colibactin's DNA-damaging activity. The data support unexpected models for both colibactin biosynthesis and its mode of action.
Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.
2016-01-01
Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621
Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio
2008-01-01
Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101
End-to-end distance and contour length distribution functions of DNA helices
NASA Astrophysics Data System (ADS)
Zoli, Marco
2018-06-01
I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen
2011-01-01
With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996
Mishra, Arpit; Ekka, Mary Krishna; Maiti, Souvik
2016-03-17
Ionic liquids (ILs) are salts with poor ionic coordination, resultantly remaining in liquid state below 100 °C and some may retain liquid state even at room temperature. ILs are known to provide a conducive environment for many biological enzymatic reactions, but their interaction with biomacromolecules are poorly understood. In the present study, we investigate the effect of various ionic liquids on DNA-small molecule interaction using calf thymus DNA (ctDNA)-ethidium bromide (EB) as a model system. The effect of various ionic liquids on these interactions is studied by an array of techniques such as circular dichroism (CD), UV melting, fluorescence exclusion and isothermal titration calorimetry. Interestingly, we observed that presence of IL increased the stability of ctDNA without altering its structure. The binding affinities Kbs for EB binding to ctDNA in the presence of 300 mM ILs are about half order of magnitude smaller than the Kbs in absence of ILs and correspond to a less favorable free energy. We noted that, when adjusted to corresponding buffer condition, the unfavorable shift in ΔG of ctDNA-EB interaction is attributed to decreased entropy in the case of ILs, whereas the same effect by NaCl was due to increased enthalpy.
THE FORM AND STRUCTURE OF KINETOPLAST DNA OF CRITHIDIA
Renger, Hartmut C.; Wolstenholme, David R.
1972-01-01
Cesium chloride centrifugation of each of the DNAs extracted from eight strains of Crithidia revealed a main band at ρ = 1.717 g/cm3 and a satellite band varying from ρ = 1.701 to 1.705 g/cm3 for the different strains By electron microscopy each DNA was shown to include circular molecules, 0.69–0.80 µ in mean contour length, and large, topologically two-dimensional masses of DNA in which the molecules appeared in the form of rosettes. DNA isolated from kinetoplast fractions of Crithidia acanthocephali was shown to consist of light satellite DNA and to be mainly in the form of large masses, 0.8 µ (mol wt = 1.54 x 106 daltons) circular molecules, and a few long, linear molecules. The results of experiments involving ultracentrifugation, heating, and quenching, sonication, and endodeoxyribonuclease digestion, combined with electron microscopy, are consistent with the following hypothesis. The large DNA masses are associations of 0.8 µ circles which are mainly covalently closed. The circles are held together in groups (the rosettes) of up to 46 by the topological interlocking of each circle with many other circles in the group. A group of circles is attached to an adjacent group by one or more circles, each interlocking with many circles of both groups. Each of the associations comprises, on the average, about 27,000 circles (total mol wt ≃ 41 x 109 daltons). A model is proposed for the in situ arrangement of the associations which takes into consideration their form and structure, and appearance in thin sections PMID:5040863
Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D
2014-01-01
The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841
Label-free in-flow detection of single DNA molecules using glass nanopipettes.
Gong, Xiuqing; Patil, Amol V; Ivanov, Aleksandar P; Kong, Qingyuan; Gibb, Thomas; Dogan, Fatma; deMello, Andrew J; Edel, Joshua B
2014-01-07
With the view of enhancing the functionality of label-free single molecule nanopore-based detection, we have designed and developed a highly robust, mechanically stable, integrated nanopipette-microfluidic device which combines the recognized advantages of microfluidic systems and the unique properties/advantages of nanopipettes. Unlike more typical planar solid-state nanopores, which have inherent geometrical constraints, nanopipettes can be easily positioned at any point within a microfluidic channel. This is highly advantageous, especially when taking into account fluid flow properties. We show that we are able to detect and discriminate between DNA molecules of varying lengths when motivated through a microfluidic channel, upon the application of appropriate voltage bias across the nanopipette. The effects of applied voltage and volumetric flow rates have been studied to ascertain translocation event frequency and capture rate. Additionally, by exploiting the advantages associated with microfluidic systems (such as flow control and concomitant control over analyte concentration/presence), we show that the technology offers a new opportunity for single molecule detection and recognition in microfluidic devices.
NASA Astrophysics Data System (ADS)
Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason
2009-03-01
The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan
2011-01-25
DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.
NASA Astrophysics Data System (ADS)
Lapin, Ivan N.; Shabalina, Anastasiia V.; Svetlichyi, Valery A.; Kolovskaya, Olga S.
2018-04-01
Nanoconstructions of gold nanoparticles (NPs) obtained via pulsed laser ablation in liquid with DNA-aptamer specific to protein tumor marker were visualized on the surface of screen-printed electrode using scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). AuNPs/aptamer nanoconstuctions distribution on the solid surface was studied. More uniform coverage of the carbon electrode surface with the nanoconstuctions was showed in comparison with DNA-aptamer alone on the golden electrode surface. Targeted binding of the tumor marker molecules with the AuNPs/DNA-aptamer nanoconstuctions was approved.
A single thiazole orange molecule forms an exciplex in a DNA i-motif.
Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei
2014-06-18
A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.
Competition between B-Z and B-L transitions in a single DNA molecule: Computational studies
NASA Astrophysics Data System (ADS)
Kwon, Ah-Young; Nam, Gi-Moon; Johner, Albert; Kim, Seyong; Hong, Seok-Cheol; Lee, Nam-Kyung
2016-02-01
Under negative torsion, DNA adopts left-handed helical forms, such as Z-DNA and L-DNA. Using the random copolymer model developed for a wormlike chain, we represent a single DNA molecule with structural heterogeneity as a helical chain consisting of monomers which can be characterized by different helical senses and pitches. By Monte Carlo simulation, where we take into account bending and twist fluctuations explicitly, we study sequence dependence of B-Z transitions under torsional stress and tension focusing on the interaction with B-L transitions. We consider core sequences, (GC) n repeats or (TG) n repeats, which can interconvert between the right-handed B form and the left-handed Z form, imbedded in a random sequence, which can convert to left-handed L form with different (tension dependent) helical pitch. We show that Z-DNA formation from the (GC) n sequence is always supported by unwinding torsional stress but Z-DNA formation from the (TG) n sequence, which are more costly to convert but numerous, can be strongly influenced by the quenched disorder in the surrounding random sequence.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki
2015-12-02
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Interplay between translational diffusion and large-amplitude angular jumps of water molecules
NASA Astrophysics Data System (ADS)
Liu, Chao; Zhang, Yangyang; Zhang, Jian; Wang, Jun; Li, Wenfei; Wang, Wei
2018-05-01
Understanding the microscopic mechanism of water molecular translational diffusion is a challenging topic in both physics and chemistry. Here, we report an investigation on the interplay between the translational diffusion and the large-amplitude angular jumps of water molecules in bulk water using molecular dynamics simulations. We found that large-amplitude angular jumps are tightly coupled to the translational diffusions. Particularly, we revealed that concurrent rotational jumps of spatially neighboring water molecules induce inter-basin translational jumps, which contributes to the fast component of the water translational diffusion. Consequently, the translational diffusion shows positional heterogeneity; i.e., the neighbors of the water molecules with inter-basin translational jumps have larger probability to diffuse by inter-basin translational jumps. Our control simulations showed that a model water molecule with moderate hydrogen bond strength can diffuse much faster than a simple Lennard-Jones particle in bulk water due to the capability of disturbing the hydrogen bond network of the surrounding water molecules. Our results added to the understanding of the microscopic picture of the water translational diffusion and demonstrated the unique features of water diffusion arising from their hydrogen bond network structure compared with those of the simple liquids.
Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter
2007-01-01
Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862
2017-01-01
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 103 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale. PMID:29166033
Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J
2018-01-10
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.
NASA Astrophysics Data System (ADS)
Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.
2018-01-01
Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Deepa; Gawel, Damian; Itsko, Mark
The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less
Singh, Deepa; Gawel, Damian; Itsko, Mark; ...
2015-02-18
The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less
DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.
Roth, M; Prescott, D M
1985-06-01
Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.
Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin
2010-06-15
Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.
Structure of nascent replicative form DNA of coliphage M13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Mitra, S.
Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less
Transposon facilitated DNA sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berg, D.E.; Berg, C.M.; Huang, H.V.
1990-01-01
The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less
Specific binding of large aggregates of amphiphilic molecules to the respective antibodies.
Nabok, Alexei; Tsargorodskaya, Anna; Holloway, Alan; Starodub, Nikolay F; Demchenko, Anna
2007-07-31
The Binding of nonylphenol to respective antibodies immobilized on solid substrates was studied with the methods of total internal reflection ellipsometry (TIRE) and QCM (quartz crystal microbalance) impedance spectroscopy. The binding reaction was proved to be highly specific having an association constant of KA=1.6x10(6) mol(-1) L and resulted in an increase in both the adsorbed layer thickness of 23 nm and the added mass of 18.3 microg/cm2 at saturation. The obtained responses of both TIRE and QCM methods are substantially higher than anticipated for the immune binding of single molecules of nonylphenol. The mechanism of binding of large aggregates of nonylphenol was suggested instead. Modeling of the micelle of amphiphilic nonylphenol molecules in aqueous solutions yielded a micelle size of about 38 nm. The mechanism of binding of large molecular aggregates to respective antibodies can be extended to other hydrophobic low-molecular-weight toxins such as T-2 mycotoxin. The formation of large molecular aggregates of nonylphenol and T-2 mycotoxin molecules on the surface was proved by the AFM study.
Large-Amplitude Deformation and Bond Breakage in Shock-Induced Reactions of Explosive Molecules
NASA Astrophysics Data System (ADS)
Kay, Jeffrey
The response of explosive molecules to large-amplitude mechanical deformation plays an important role in shock-induced reactions and the initiation of detonation in explosive materials. In this presentation, the response of a series of explosive molecules (nitromethane, 2,4,6-trinitrotoluene [TNT], and 2,4,6-triamino-1,3,5-trinitrobenzene [TATB]) to a variety of large-amplitude deformations are examined using ab initio quantum chemical calculations. Large-amplitude motions that result in bond breakage are described, and the insights these results provide into both previous experimental observations and previous theoretical predictions of shock-induced reactions are discussed.
ERIC Educational Resources Information Center
Beltramini, Leila Maria; Araujo, Ana Paula Ulian; de Oliveira, Tales Henrique Goncalves; dos Santos Abel, Luciano Douglas; da Silva, Aparecido Rodrigues; dos Santos, Neusa Fernandes
2006-01-01
International specialized literature focused on research in biology education is sadly scarce, especially regarding biochemical and molecular aspects. In this light, researchers from this Centre for Structural Molecular Biotechnology developed and evaluated a three-dimensional educational model named "Building Life Molecules DNA and RNA." The…
Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C
2018-02-06
Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.
NASA Astrophysics Data System (ADS)
Rybenkov, Valentin V.
2016-09-01
The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].
NASA Astrophysics Data System (ADS)
Sepehri, Alireza
Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.
Zhang, Hao; Li, Yan; Su, Xingguang
2013-11-15
In this paper, we establish a novel fluorescence-sensing system for the detection of biotin based on the interaction between DNA and graphene oxide and on protection of the terminal of the biotinylated single-stranded DNA fluorescent probe by streptavidin. In this system, streptavidin binds to the biotinylated DNA, which protects the DNA from hydrolysis by exonuclease I. The streptavidin-DNA conjugate is then adsorbed to the graphene oxide resulting in the fluorescence being quenched. Upon the addition of free biotin, it competes with the labeled biotin for the binding sites of streptavidin and then the exonuclease I digests the unbound DNA probe from the 3' to the 5' terminal, releasing the fluorophore from the DNA. Because of the weak affinity between the fluorophore and graphene oxide, the fluorescence is recovered. Under optimal conditions, the fluorescence intensity is proportional to the concentration of biotin in the concentration range of 0.5-20nmol/L. The detection limit for biotin is 0.44nmol/L. The proposed fluorescence-sensing system was applied to the determination of biotin in some real samples with satisfactory reproducibility and accuracy. This work could provide a common platform for detecting small biomolecules based on protein-small molecule ligand binding. Copyright © 2013 Elsevier Inc. All rights reserved.
Pilger, Beatrice D; Cui, Can; Coen, Donald M
2004-05-01
The interaction between the catalytic subunit Pol and the processivity subunit UL42 of herpes simplex virus DNA polymerase has been characterized structurally and mutationally and is a potential target for novel antiviral drugs. We developed and validated an assay for small molecules that could disrupt the interaction of UL42 and a Pol-derived peptide and used it to screen approximately 16,000 compounds. Of 37 "hits" identified, four inhibited UL42-stimulated long-chain DNA synthesis by Pol in vitro, of which two exhibited little inhibition of polymerase activity by Pol alone. One of these specifically inhibited the physical interaction of Pol and UL42 and also inhibited viral replication at concentrations below those that caused cytotoxic effects. Thus, a small molecule can inhibit this protein-protein interaction, which provides a starting point for the discovery of new antiviral drugs.
He, Yuhui; Tsutsui, Makusu; Scheicher, Ralph H.; Fan, Chun; Taniguchi, Masateru; Kawai, Tomoji
2013-01-01
Experiments using nanopores demonstrated that a salt gradient enhances the capture rate of DNA and reduces its translocation speed. These two effects can help to enable electrical DNA sequencing with nanopores. Here, we provide a quantitative theoretical evaluation that shows the positive net charges, which accumulate around the pore entrance due to the salt gradient, are responsible for the two observed effects: they reinforce the electric capture field, resulting in promoted molecule capture rate; and they induce cationic electroosmotic flow through the nanopore, thus significantly retarding the motion of the anionic DNA through the nanopore. Our multiphysical simulation results show that, during the polymer trapping stage, the former effect plays the major role, thus resulting in promoted DNA capture rate, while during the nanopore-penetrating stage the latter effect dominates and consequently reduces the DNA translocation speed significantly. Quantitative agreement with experimental results has been reached by further taking nanopore wall surface charges into account. PMID:23931325
Jose, K V Jovan; Raghavachari, Krishnan
2016-12-01
The molecules-in-molecules (MIM) fragment-based method has recently been adapted to evaluate the chiroptical (vibrational circular dichroism [VCD] and Raman optical activity [ROA]) spectra of large molecules such as peptides. In the MIM-VCD and MIM-ROA methods, the relevant higher energy derivatives of the parent molecule are assembled from the corresponding derivatives of smaller fragment subsystems. In addition, the missing long-range interfragment interactions are accounted at a computationally less expensive level of theory (MIM2). In this work we employed the MIM-VCD and MIM-ROA fragment-based methods to explore the evolution of the chiroptical spectroscopic characteristics of 3 10 -helix, α-helix, β-hairpin, γ-turn, and β-extended conformers of gas phase polyalanine (chain length n = 6-14). The different conformers of polyalanine show distinctive features in the MIM chiroptical spectra and the associated spectral intensities increase with evolution of system size. For a better understanding the site-specific effects on the vibrational spectra, isotopic substitutions were also performed employing the MIM method. An increasing redshift with the number of isotopically labeled 13 C=O functional groups in the peptide molecule was seen. For larger polypeptides, we implemented the two-step-MIM model to circumvent the high computational expense associated with the evaluation of chiroptical spectra at a high level of theory using large basis sets. The chiroptical spectra of α-(alanine) 20 polypeptide obtained using the two-step-MIM model, including continuum solvation effects, show good agreement with the full calculations and experiment. This benchmark study suggests that the MIM-fragment approach can assist in predicting and interpreting chiroptical spectra of large polypeptides. © 2016 Wiley Periodicals, Inc.
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266
Kumar, S. Suresh; Alarfaj, Abdullah A.; Munusamy, Murugan A.; Singh, A. J. A. Ranjith; Peng, I-Chia; Priya, Sivan Padma; Hamat, Rukman Awang; Higuchi, Akon
2014-01-01
Human pluripotent stem cells, including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), hold promise as novel therapeutic tools for diabetes treatment because of their self-renewal capacity and ability to differentiate into beta (β)-cells. Small and large molecules play important roles in each stage of β-cell differentiation from both hESCs and hiPSCs. The small and large molecules that are described in this review have significantly advanced efforts to cure diabetic disease. Lately, effective protocols have been implemented to induce hESCs and human mesenchymal stem cells (hMSCs) to differentiate into functional β-cells. Several small molecules, proteins, and growth factors promote pancreatic differentiation from hESCs and hMSCs. These small molecules (e.g., cyclopamine, wortmannin, retinoic acid, and sodium butyrate) and large molecules (e.g. activin A, betacellulin, bone morphogentic protein (BMP4), epidermal growth factor (EGF), fibroblast growth factor (FGF), keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), noggin, transforming growth factor (TGF-α), and WNT3A) are thought to contribute from the initial stages of definitive endoderm formation to the final stages of maturation of functional endocrine cells. We discuss the importance of such small and large molecules in uniquely optimized protocols of β-cell differentiation from stem cells. A global understanding of various small and large molecules and their functions will help to establish an efficient protocol for β-cell differentiation. PMID:25526563
Methods of DNA methylation detection
NASA Technical Reports Server (NTRS)
Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)
2010-01-01
The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.
NASA Astrophysics Data System (ADS)
Fessl, Tomas; Ben-Yaish, Shai; Vacha, Frantisek; Adamec, Frantisek; Zalevsky, Zeev
2009-07-01
Imaging of small objects such as single molecules, DNA clusters and single bacterial cells is problematic not only due to the lateral resolution that is obtainable in currently existing microscopy but also, and as much fundamentally limiting, due to the lack of sufficient axial depth of focus to have the full object focused simultaneously. Extension in depth of focus is helpful also for single molecule steady state FRET measurements. In this technique it is crucial to obtain data from many well focused molecules, which are often located in different axial depths. In this paper we present the implementation of an all-optical and a real time technique of extension in the depth of focus that may be incorporated in any high NA microscope system and to be used for the above mentioned applications. We demonstrate experimentally how after the integration of special optical element in high NA 100× objective lens of a single molecule imaging microscope system, the depth of focus is significantly improved while maintaining the same lateral resolution in imaging applications of incorporated groups of molecules, DNA constructs and clusters inside bacterial cells.
Blakskjaer, Peter; Heitner, Tara; Hansen, Nils Jakob Vest
2015-06-01
DNA-encoded small-molecule library (DEL) technology allows vast drug-like small molecule libraries to be efficiently synthesized in a combinatorial fashion and screened in a single tube method for binding, with an assay readout empowered by advances in next generation sequencing technology. This approach has increasingly been applied as a viable technology for the identification of small-molecule modulators to protein targets and as precursors to drugs in the past decade. Several strategies for producing and for screening DELs have been devised by both academic and industrial institutions. This review highlights some of the most significant and recent strategies along with important results. A special focus on the production of high fidelity DEL technologies with the ability to eliminate screening noise and false positives is included: using a DNA junction called the Yoctoreactor, building blocks (BBs) are spatially confined at the center of the junction facilitating both the chemical reaction between BBs and encoding of the synthetic route. A screening method, known as binder trap enrichment, permits DELs to be screened robustly in a homogeneous manner delivering clean data sets and potent hits for even the most challenging targets. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi
2009-10-22
Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.
A Survey of Large Molecules toward the Protoplanetary Nebula CRL 61 8
NASA Technical Reports Server (NTRS)
Remijan, Anthony J.; Wyrowski, Friedrich; Friedel, Douglas N.; Meier, David S.; Snyder, Lewis E.
2005-01-01
We present the results of our survey toward the protoplanetary nebula CRL 618 for several large, highly saturated, oxygen bearing organic molecules of biological importance including acetaldehyde (CH3CHO), acetic acid (CH3OOH), dimethyl ether (CH3OCH3), ethanol (CH3CH2OH), formic acid (HCOOH) and methyl formate (HCOOCH3); large carbon chain molecules including methyl cyanide (CH3CN) , methylcyanoacetylene (CH3C3N), cyanoacetylene (HC3N), cyanodiacetylene (HC5N), and C6H; and finally smaller molecules including SO-34, SO2, O(C-34)S and MgNC. No biologically important organic molecules were detected. However, we report the first interferometric detections of CH3CN and vibrationally excited HC3N and HC5N toward this source. The temperature and distribution of CH3CN toward CRL 618 indicates it is formed in the outer envelope surrounding the UC HII region. Furthermore, the P-Cygni line profile and corresponding channel maps of vibrationally excited HC5N supports its distribution in the extended envelope expanding radially from the central star. The detection of vibrationally excited HC3N confirmed the temperature structure and column density of HC3N in the inner envelope found by Wyrowski and colleagues (2003). Finally, our observations clearly indicate that CRL 618 is a good source of large carbon chain species but is a very poor source to detect or produce organic species of biological importance.
Visnapuu, Mari-Liis; Fazio, Teresa; Wind, Shalom; Greene, Eric C.
2009-01-01
The analysis of individual molecules is evolving into an important tool for biological research, and presents conceptually new ways of approaching experimental design strategies. However, more robust methods are required if these technologies are to be made broadly available to the biological research community. To help achieve this goal we have combined nanofabrication techniques with single-molecule optical microscopy for assembling and visualizing curtains comprised of thousands of individual DNA molecules organized at engineered diffusion barriers on a lipid bilayer-coated surface. Here we present an important extension of this technology that implements geometric barrier patterns comprised of thousands of nanoscale wells that can be loaded with single molecules of DNA. We show that these geometric nanowells can be used to precisely control the lateral distribution of the individual DNA molecules within curtains assembled along the edges of the engineered barrier patterns. The individual molecules making up the DNA curtain can be separated from one another by a user-defined distance dictated by the dimensions of the nanowells. We demonstrate the broader utility of these patterned DNA curtains in a novel, real time restriction assay that we refer to as dynamic optical restriction mapping, which can be used to rapidly identify entire sets of cleavage sites within a large DNA molecule. PMID:18788761
Dynamics of single-stranded DNA tethered to a solid
NASA Astrophysics Data System (ADS)
Radiom, Milad; Paul, Mark R.; Ducker, William A.
2016-06-01
Tethering is used to deliver specific biological and industrial functions. For example, single-stranded DNA (ssDNA) is tethered to polymerases and long sequences of double-stranded DNA (dsDNA) during replication, and to solids in DNA microarrays. However, tethering ssDNA to a large object limits not only the available ssDNA conformations, but also the range of time-scales over which the mechanical responses of ssDNA are important. In this work we examine the effect of tethering by measurement of the mechanical response of ssDNA that is tethered at each end to two separate atomic force microscope cantilevers in aqueous solution. Thermal motion of the cantilevers drives the ends of the ssDNA chain at frequencies near 2 kHz. The presence of a tethered molecule makes a large difference to the asymmetric cross-correlation of two cantilevers, which enables resolution of the mechanical properties in our experiments. By analysis of the correlated motion of the cantilevers we extract the friction and stiffness of the ssDNA. We find that the measured friction is much larger than the friction that is usually associated with the unencumbered motion of ssDNA. We also find that the measured relaxation time, ∼30 μs, is much greater than prior measurements of the free-molecule relaxation time. We attribute the difference to the loss of conformational possibilities as a result of constraining the ends of the ssDNA.
Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D
2013-07-01
The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.
Adsorption of plasmid DNA on anion exchange chromatography media.
Tarmann, Christina; Jungbauer, Alois
2008-08-01
Anion exchange chromatography (AEC) is a useful and effective tool for DNA purification, but due to average pore sizes between 40 and 100 nm most AEC resins lack truly useful binding capacities for plasmid DNA (pDNA). Equilibrium binding capacities and uptake kinetics of AEC media including conventional media (Source 30 Q, Q Sepharose HP), a polymer grafted medium (Fractogel EMD DEAE (M)), media with large pores (Celbeads DEAE, PL SAX 4000 A 30 microm) and a monolithic medium (CIM-DEAE) were investigated by batch uptake or shallow bed experiments at two salt concentrations. Theoretical and experimental binding capacities suggest that the shape of the pDNA molecule can be described by a rod with a length to diameter ratio of 20:1 and that the molecule binds in upright position. The arrangement of DNA like a brush at the surface can be considered as entropy driven, kind of self-assembly process which is inherent to highly and uniformly charged DNA molecules. The initial phase of adsorption is very fast and levels off, associated with a change in mass transfer mechanism. Feed concentrations higher than 0.1 mg/mL pDNA pronounce this effect. Monolithic media showed the fastest adsorption rate and highest binding capacity with 13 mg pDNA per mL.
Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang
2017-01-01
Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398
Manipulating the motion of large molecules: Information from the molecular frame
NASA Astrophysics Data System (ADS)
Küpper, Jochen
2011-05-01
Large molecules have complex potential-energy surfaces with many local minima. They exhibit multiple stereoisomers, even at the low temperatures (~1 K) in a molecular beam, with rich intra- and intermolecular dynamics. Over the last years, we have developed methods to manipulate the motion of large, complex molecules and to select their quantum states. We have exploited this state-selectivity, for example, to spatially separate individual structural isomers of complex molecules and to demonstrate unprecedented degrees of laser alignment and mixed-field orientation of these molecules. Such clean, well-defined samples strongly benefit, or simply allow, novel experiments on the dynamics of complex molecules, for instance, femtosecond pump-probe measurements, X-ray or electron diffraction of molecular ensembles (including diffraction-from-within experiments), or tomographic reconstructions of molecular orbitals. These samples could also be very advantageous for metrology applications, such as, for example, matter-wave interferometry or the search for electroweak interactions in chiral molecules. Moreover, they provide an extreme level of control for stereo-dynamically controlled reaction dynamics. We have recently exploited these state-selected and oriented samples to measure photoelectron angular distributions in the molecular frame (MFPADs) from non-resonant femtosecond-laser photoionization and using the X-ray Free-Electron-Laser LCLS. We have also investigated X-ray diffraction imaging and, using ion momentum imaging, the induced radiation damage of these samples using the LCLS. This work was carried out within a collaboration for which J. Küpper, H. Chapman, and D. Rolles are spokespersons. The collaboration consists of CFEL (DESY, MPG, University Hamburg), Fritz-Haber-Institute Berlin, MPI Nuclear Physics Heidelberg, MPG Semi-conductor Lab, Aarhus University, FOM AMOLF Amsterdam, Lund University, MPI Medical Research Heidelberg, TU Berlin, Max Born Institute
Visualization of yeast chromosomal DNA
NASA Technical Reports Server (NTRS)
Lubega, Seth
1990-01-01
The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.
Han, Le; Pandian, Ganesh N; Chandran, Anandhakumar; Sato, Shinsuke; Taniguchi, Junichi; Kashiwazaki, Gengo; Sawatani, Yoshito; Hashiya, Kaori; Bando, Toshikazu; Xu, Yufang; Qian, Xuhong; Sugiyama, Hiroshi
2015-07-20
Synthetic dual-function ligands targeting specific DNA sequences and histone-modifying enzymes were applied to achieve regulatory control over multi-gene networks in living cells. Unlike the broad array of targeting small molecules for histone deacetylases (HDACs), few modulators are known for histone acetyltransferases (HATs), which play a central role in transcriptional control. As a novel chemical approach to induce selective HAT-regulated genes, we conjugated a DNA-binding domain (DBD) "I" to N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-benzamide (CTB), an artificial HAT activator. In vitro enzyme activity assays and microarray studies were used to demonstrate that distinct functional small molecules could be transformed to have identical bioactivity when conjugated with a targeting DBD. This proof-of-concept synthetic strategy validates the switchable functions of HDACs and HATs in gene regulation and provides a molecular basis for developing versatile bioactive ligands. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T
2018-01-23
Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.
Itzhaki, Ruth F.
1971-01-01
The binding of deoxyribonucleoprotein to Toluidine Blue, to cetylpyridinium chloride and to polylysine of various molecular weights was studied to determine the percentage of free DNA phosphate groups in deoxyribonucleoprotein. Binding was measured by addition of these reagents to deoxyribonucleoprotein at a range of concentrations such that complete precipitation of the deoxyribonucleoprotein occurred. With Toluidine Blue the binding corresponded to about 48% of the DNA phosphates in deoxyribonucleoprotein. The dye did not cause appreciable displacement of protein from the DNA. With cetylpyridinium chloride the binding corresponded to about 41% of the DNA phosphates. With polylysine preparations of molecular weight 1250 and 7790 the binding values for deoxyribonucleoprotein were 46 and 38% respectively. The results suggest that the free phosphates lie in stretches sufficiently long to accommodate most of each polylysine molecule. With polylysine of molecular weight 62000 cross-linking of free stretches of DNA on different deoxyribonucleoprotein molecules probably occurs. It is concluded that although most of the free phosphates are probably `hidden' beneath covering histone, corresponding perhaps to runs of non-basic residues in the latter, they are surprisingly accessible to very large molecules. The relevance of this finding to the problem of gene repression is discussed. PMID:5166331
DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior
Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.
2016-01-01
DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503
A new electrochemical method for the detection of cancer cells based on small molecule-linked DNA.
Zhao, Jing; Zhu, Li; Guo, Chao; Gao, Tao; Zhu, Xiaoli; Li, Genxi
2013-11-15
Sensitive and accurate detection of cancer cells plays a crucial role in clinical diagnosis, treatment and prognosis of tumors. In this paper, we report a new electrochemical method for highly selective and sensitive detection of cancer cells by using small molecule-linked DNA as probes. The methodology is based on the fact that exonuclease I can catalyze the digestion of folate-linked DNA probes that are immobilized on an electrode surface; however, in the presence of the target cells, such as human breast cancer MCF-7 cells, the probes can be protected from digestion upon the binding with folate receptor that is over-expressed on the cell surface. Consequently, cancer cells can be efficiently detected by monitoring the status of the probe DNA with electrochemical techniques. In this study, the protection to exonuclease I-catalyzed digestion has also been proven by electrochemical studies. Moreover, the proposed method has been proven to linearly detect MCF-7 cells in a wide range from 10(2)-10(6) cell mL(-1) with a low detection limit of 67 cell mL(-1), which can also easily distinguish the folate receptor-negative normal cells, for instance, islet β cells. The reproduction of the detection is also satisfactory, since the relative standard deviations for three independent measurements of different concentration of MCF-7 cells are all within 10%. By replacing the small molecules linked on the DNA probe, other cancer cells can also be detected by making use of this proposed method. Therefore, our cytosensor may have great potential in clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.
Small-Molecule-Based Self-Assembled Ligands for G-Quadruplex DNA Surface Recognition.
Rivera-Sánchez, María Del C; García-Arriaga, Marilyn; Hobley, Gerard; Morales-de-Echegaray, Ana V; Rivera, José M
2017-10-31
Most drugs are small molecules because of their attractive pharmacokinetics, manageable development and manufacturing, and effective binding into the concave crevices of bio-macromolecules. Despite these features, they often fall short when it comes to effectively recognizing the surfaces of bio-macromolecules. One way to overcome the challenge of biomolecular surface recognition is to develop small molecules that become self-assembled ligands (SALs) prior to binding. Herein, we report SALs made from 8-aryl-2'-deoxyguanosine derivatives forming precise hydrophilic supramolecular G-quadruplexes (SGQs) with excellent size, shape, and charge complementarity to G-quadruplex DNA (QDNA). We show that only those compounds forming SGQs act as SALs, which in turn differentially stabilize QDNAs from selected oncogene promoters and the human telomeric regions. Fluorescence resonance energy-transfer melting assays are consistent with spectroscopic, calorimetric, and light scattering studies, showing the formation of a "sandwichlike" complex QDNA·SGQ·QDNA. These results open the door for the advent of SALs that recognize QDNAs and potentially the surfaces of other bio-macromolecules such as proteins.
2016-01-01
Digital single-molecule technologies are expanding diagnostic capabilities, enabling the ultrasensitive quantification of targets, such as viral load in HIV and hepatitis C infections, by directly counting single molecules. Replacing fluorescent readout with a robust visual readout that can be captured by any unmodified cell phone camera will facilitate the global distribution of diagnostic tests, including in limited-resource settings where the need is greatest. This paper describes a methodology for developing a visual readout system for digital single-molecule amplification of RNA and DNA by (i) selecting colorimetric amplification-indicator dyes that are compatible with the spectral sensitivity of standard mobile phones, and (ii) identifying an optimal ratiometric image-process for a selected dye to achieve a readout that is robust to lighting conditions and camera hardware and provides unambiguous quantitative results, even for colorblind users. We also include an analysis of the limitations of this methodology, and provide a microfluidic approach that can be applied to expand dynamic range and improve reaction performance, allowing ultrasensitive, quantitative measurements at volumes as low as 5 nL. We validate this methodology using SlipChip-based digital single-molecule isothermal amplification with λDNA as a model and hepatitis C viral RNA as a clinically relevant target. The innovative combination of isothermal amplification chemistry in the presence of a judiciously chosen indicator dye and ratiometric image processing with SlipChip technology allowed the sequence-specific visual readout of single nucleic acid molecules in nanoliter volumes with an unmodified cell phone camera. When paired with devices that integrate sample preparation and nucleic acid amplification, this hardware-agnostic approach will increase the affordability and the distribution of quantitative diagnostic and environmental tests. PMID:26900709
DNA encoding a DNA repair protein
Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick
2006-08-15
An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.
Injectable controlled release depots for large molecules
Schwendeman, Steven P.; Shah, Ronak B.; Bailey, Brittany A.; Schwendeman, Anna S.
2014-01-01
Biodegradable, injectable depot formulations for long-term controlled drug release have improved therapy for a number of drug molecules and led to over a dozen highly successful pharmaceutical products. Until now, success has been limited to several small molecules and peptides, although remarkable improvements have been accomplished in some of these cases. For example, twice-a-year depot injections with leuprolide are available compared to the once-a-day injection of the solution dosage form. Injectable depots are typically prepared by encapsulation of the drug in poly(lactic-co-glycolic acid) (PLGA), a polymer that is used in children every day as a resorbable suture material, and therefore, highly biocompatible. PLGAs remain today as one of the few “real world” biodegradable synthetic biomaterials used in US FDA-approved parenteral long-acting-release (LAR) products. Despite their success, there remain critical barriers to the more widespread use of PLGA LAR products, particularly for delivery of more peptides and other large molecular drugs, namely proteins. In this review, we describe key concepts in the development of injectable PLGA controlled-release depots for peptides and proteins, and then use this information to identify key issues impeding greater widespread use of PLGA depots for this class of drugs. Finally, we examine important approaches, particularly those developed in our research laboratory, toward overcoming these barriers to advance commercial LAR development. PMID:24929039
ERIC Educational Resources Information Center
Brinner, Bonnie
1992-01-01
Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)
Quantum interference experiments with large molecules
NASA Astrophysics Data System (ADS)
Nairz, Olaf; Arndt, Markus; Zeilinger, Anton
2003-04-01
Wave-particle duality is frequently the first topic students encounter in elementary quantum physics. Although this phenomenon has been demonstrated with photons, electrons, neutrons, and atoms, the dual quantum character of the famous double-slit experiment can be best explained with the largest and most classical objects, which are currently the fullerene molecules. The soccer-ball-shaped carbon cages C60 are large, massive, and appealing objects for which it is clear that they must behave like particles under ordinary circumstances. We present the results of a multislit diffraction experiment with such objects to demonstrate their wave nature. The experiment serves as the basis for a discussion of several quantum concepts such as coherence, randomness, complementarity, and wave-particle duality. In particular, the effect of longitudinal (spectral) coherence can be demonstrated by a direct comparison of interferograms obtained with a thermal beam and a velocity selected beam in close analogy to the usual two-slit experiments using light.
Ketone-DNA: a versatile postsynthetic DNA decoration platform.
Dey, S; Sheppard, T L
2001-12-13
[reaction: see text] A general strategy for the functional diversification of DNA oligonucleotides under physiological conditions was developed. We describe the synthesis of DNA molecules bearing ketone ports (ketone-DNA) and the efficient postsynthetic decoration of ketone-DNA with structurally diverse aminooxy compounds.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
Molecular dynamics of DNA quadruplex molecules containing inosine, 6-thioguanine and 6-thiopurine.
Stefl, R; Spacková, N; Berger, I; Koca, J; Sponer, J
2001-01-01
The ability of the four-stranded guanine (G)-DNA motif to incorporate nonstandard guanine analogue bases 6-oxopurine (inosine, I), 6-thioguanine (tG), and 6-thiopurine (tI) has been investigated using large-scale molecular dynamics simulations. The simulations suggest that a G-DNA stem can incorporate inosines without any marked effect on its structure and dynamics. The all-inosine quadruplex stem d(IIII)(4) shows identical dynamical properties as d(GGGG)(4) on the nanosecond time scale, with both molecular assemblies being stabilized by monovalent cations residing in the channel of the stem. However, simulations carried out in the absence of these cations show dramatic differences in the behavior of d(GGGG)(4) and d(IIII)(4). Whereas vacant d(GGGG)(4) shows large fluctuations but does not disintegrate, vacant d(IIII)(4) is completely disrupted within the first nanosecond. This is a consequence of the lack of the H-bonds involving the N2 amino group that is not present in inosine. This indicates that formation of the inosine quadruplex could involve entirely different intermediate structures than formation of the guanosine quadruplex, and early association of cations in this process appears to be inevitable. In the simulations, the incorporation of 6-thioguanine and 6-thiopurine sharply destabilizes four-stranded G-DNA structures, in close agreement with experimental data. The main reason is the size of the thiogroup leading to considerable steric conflicts and expelling the cations out of the channel of the quadruplex stem. The G-DNA stem can accommodate a single thioguanine base with minor perturbations. Incorporation of a thioguanine quartet layer is associated with a large destabilization of the G-DNA stem whereas the all-thioguanine quadruplex immediately collapses. PMID:11159416
Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I
2015-12-14
DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.
Observation of Single-Protein and DNA Macromolecule Collisions on Ultramicroelectrodes.
Dick, Jeffrey E; Renault, Christophe; Bard, Allen J
2015-07-08
Single-molecule detection is the ultimate sensitivity in analytical chemistry and has been largely unavailable in electrochemical analysis. Here, we demonstrate the feasibility of detecting electrochemically inactive single biomacromolecules, such as enzymes, antibodies, and DNA, by blocking a solution redox reaction when molecules adsorb and block electrode sites. By oxidizing a large concentration of potassium ferrocyanide on an ultramicroelectrode (UME, radius ≤150 nm), time-resolved, discrete adsorption events of antibodies, enzymes, DNA, and polystyrene nanospheres can be differentiated from the background by their "footprint". Further, by assuming that the mass transport of proteins to the electrode surface is controlled mainly by diffusion, a size estimate using the Stokes-Einstein relationship shows good agreement of electrochemical data with known protein sizes.
The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.
Magna, Melinda; Pisetsky, David S
2016-05-01
The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Seeman, Nadrian C.
2012-01-01
The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824
Pandian, Ganesh N; Ohtsuki, Akimichi; Bando, Toshikazu; Sato, Shinsuke; Hashiya, Kaori; Sugiyama, Hiroshi
2012-04-15
Epigenetic modifications that govern the gene expression are often overlooked with the design of artificial genetic switches. N-Methylpyrrole-N-methylimidazole (PI) hairpin polyamides are programmable small DNA binding molecules that have been studied in the context of gene regulation. Recently, we synthesized a library of compounds by conjugating PI polyamides with SAHA, a chromatin-modifier. Among these novel compounds, PI polyamide-SAHA conjugate 1 was shown to epigenetically activate pluripotency genes in mouse embryonic fibroblasts. Here, we report the synthesis of the derivatives of conjugate 1 and demonstrate that these epigenetically active molecules could be developed to improve the induction of pluripotency factors. Copyright © 2012 Elsevier Ltd. All rights reserved.
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Atomic-scale imaging of DNA using scanning tunnelling microscopy.
Driscoll, R J; Youngquist, M G; Baldeschwieler, J D
1990-07-19
The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.
Gitman, A G; Graessmann, A; Loyter, A
1985-11-01
Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.
Gitman, A G; Graessmann, A; Loyter, A
1985-01-01
Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783
NASA Astrophysics Data System (ADS)
Thubagere, Anupama J.; Thachuk, Chris; Berleant, Joseph; Johnson, Robert F.; Ardelean, Diana A.; Cherry, Kevin M.; Qian, Lulu
2017-02-01
Biochemical circuits made of rationally designed DNA molecules are proofs of concept for embedding control within complex molecular environments. They hold promise for transforming the current technologies in chemistry, biology, medicine and material science by introducing programmable and responsive behaviour to diverse molecular systems. As the transformative power of a technology depends on its accessibility, two main challenges are an automated design process and simple experimental procedures. Here we demonstrate the use of circuit design software, combined with the use of unpurified strands and simplified experimental procedures, for creating a complex DNA strand displacement circuit that consists of 78 distinct species. We develop a systematic procedure for overcoming the challenges involved in using unpurified DNA strands. We also develop a model that takes synthesis errors into consideration and semi-quantitatively reproduces the experimental data. Our methods now enable even novice researchers to successfully design and construct complex DNA strand displacement circuits.
Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js
2018-05-08
DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.
Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.
Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki
2016-11-29
DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.
Generating the Infrared Spectra of Large Interstellar Molecules with Density Functional Theory
NASA Technical Reports Server (NTRS)
Bauschlicher, Charles W., Jr.; Arnold, James (Technical Monitor)
1999-01-01
It is now possible to compute IR (infrared) spectra of large molecules with an accuracy of 30 per cm, or better, using density function theory. This is true for cations, anions, and neutrals. Thus it possible to generate synthetic IR spectra that can help interpret experimental spectra and fill in for missing experimental data. These synthetic spectra can be used as input into interstellar models. In addition to IR spectra, it is possible to compute energetic properties to help understand which molecules can be formed in the interstellar environment.
In search of multipath interference using large molecules
Cotter, Joseph P.; Brand, Christian; Knobloch, Christian; Lilach, Yigal; Cheshnovsky, Ori; Arndt, Markus
2017-01-01
The superposition principle is fundamental to the quantum description of both light and matter. Recently, a number of experiments have sought to directly test this principle using coherent light, single photons, and nuclear spin states. We extend these experiments to massive particles for the first time. We compare the interference patterns arising from a beam of large dye molecules diffracting at single, double, and triple slit material masks to place limits on any high-order, or multipath, contributions. We observe an upper bound of less than one particle in a hundred deviating from the expectations of quantum mechanics over a broad range of transverse momenta and de Broglie wavelength. PMID:28819641
Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions.
Brown, Maxwell W; Kim, Yoori; Williams, Gregory M; Huck, John D; Surtees, Jennifer A; Finkelstein, Ilya J
2016-02-03
DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2-Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2-Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2-Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2-Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2-Msh3 and Msh2-Msh6 navigate on a crowded genome and suggest how Msh2-Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin.
Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.
Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F
2011-08-01
Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.
Advantage of spatial map ion imaging in the study of large molecule photodissociation
NASA Astrophysics Data System (ADS)
Lee, Chin; Lin, Yen-Cheng; Lee, Shih-Huang; Lee, Yin-Yu; Tseng, Chien-Ming; Lee, Yuan-Tseh; Ni, Chi-Kung
2017-07-01
The original ion imaging technique has low velocity resolution, and currently, photodissociation is mostly investigated using velocity map ion imaging. However, separating signals from the background (resulting from undissociated excited parent molecules) is difficult when velocity map ion imaging is used for the photodissociation of large molecules (number of atoms ≥ 10). In this study, we used the photodissociation of phenol at the S1 band origin as an example to demonstrate how our multimass ion imaging technique, based on modified spatial map ion imaging, can overcome this difficulty. The photofragment translational energy distribution obtained when multimass ion imaging was used differed considerably from that obtained when velocity map ion imaging and Rydberg atom tagging were used. We used conventional translational spectroscopy as a second method to further confirm the experimental results, and we conclude that data should be interpreted carefully when velocity map ion imaging or Rydberg atom tagging is used in the photodissociation of large molecules. Finally, we propose a modified velocity map ion imaging technique without the disadvantages of the current velocity map ion imaging technique.
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA
2011-01-18
A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.
Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan
2012-10-08
One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.
An improved DNA force field for ssDNA interactions with gold nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Xiankai; Huai, Ping; Fan, Chunhai
The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones “protecting” hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thusmore » the “protection” by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.« less
An improved DNA force field for ssDNA interactions with gold nanoparticles
NASA Astrophysics Data System (ADS)
Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo
2014-06-01
The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.
An improved DNA force field for ssDNA interactions with gold nanoparticles.
Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo
2014-06-21
The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
Large low-field magnetoresistance in Fe3O4/molecule nanoparticles at room temperature
NASA Astrophysics Data System (ADS)
Yue, F. J.; Wang, S.; Lin, L.; Zhang, F. M.; Li, C. H.; Zuo, J. L.; Du, Y. W.; Wu, D.
2011-01-01
Acetic acid molecule-coated Fe3O4 nanoparticles, 450-650 nm in size, have been synthesized using a chemical solvothermal reduction method. Fourier transform infrared spectroscopy measurements confirm one monolayer acetic acid molecules chemically bond to the Fe3O4 nanoparticles. The low-field magnetoresistance (LFMR) of more than -10% at room temperature and -23% at 140 K is achieved with saturation field of less than 2 kOe. In comparison, the resistivity of cold-pressed bare Fe3O4 nanoparticles is six orders of magnitudes smaller than that of Fe3O4/molecule nanoparticles, and the LFMR ratio is one order of magnitude smaller. Our results indicate that the large LFMR in Fe3O4/molecule nanoparticles is associated with spin-polarized electrons tunnelling through molecules instead of direct nanoparticle contacts. These results suggest that magnetic oxide-molecule hybrid materials are an alternative type of materials to develop spin-based devices by a simple low-cost approach.
Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles
Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.
2008-01-01
We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366
Identifying DNA methylation in a nanochannel
NASA Astrophysics Data System (ADS)
Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu
2016-01-01
DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.
DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale
Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.
2015-01-01
Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731
Irradiation of DNA loaded with platinum containing molecules by fast atomic ions C(6+) and Fe(26+).
Usami, N; Kobayashi, K; Furusawa, Y; Frohlich, H; Lacombe, S; Sech, C Le
2007-09-01
In order to study the role of the Linear Energy Transfer (LET) of fast atomic ions in platinum-DNA complexes inducing breaks, DNA Plasmids were irradiated by C(6+) and Fe(26+) ions. DNA Plasmids (pBR322) loaded with different amounts of platinum contained in a terpyridine-platinum molecule (PtTC) were irradiated by C(6+) ions and Fe(26+) ions. The LET values ranged between 13.4 keV/microm and 550 keV/microm. In some experiments, dimethyl sulfoxide (DMSO) was added. In all experiments, a significant increase in DNA strand breaks was observed when platinum was present. The yield of breaks induced per Gray decreased when the LET increased. The yield of single and double strand breaks per plasmid per track increased with the LET, indicating that the number of DNA breaks per Gray was related to the number of tracks through the medium. These findings show that more DNA breaks are induced by atomic ions when platinum is present. This effect increases for low LET heavy atoms. As DSB induction may induce cell death, these results could open new perspectives with the association of hadrontherapy and chemotherapy. Thus the therapeutic index might be improved by loading the tumour with platinum salts.
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265
ERIC Educational Resources Information Center
Eckert, J. M.
1973-01-01
Discusses formation of chemical molecules via Mobius strip intermediates, and concludes that many special physics-chemical properties of the fully closed circular form (1) of polyoma DNA are explainable by this topological feature. (CC)
An improved method for large-scale preparation of negatively and positively supercoiled plasmid DNA.
Barth, Marita; Dederich, Debra; Dedon, Peter
2009-07-01
A rigorous understanding of the biological function of superhelical tension in cellular DNA requires the development of new tools and model systems for study. To this end, an ethidium bromide[#x02013]free method has been developed to prepare large quantities of either negatively or positively super-coiled plasmid DNA. The method is based upon the known effects of ionic strength on the direction of binding of DNA to an archaeal histone, rHMfB, with low and high salt concentrations leading to positive and negative DNA supercoiling, respectively. In addition to fully optimized conditions for large-scale (>500 microg) supercoiling reactions, the method is advantageous in that it avoids the use of mutagenic ethidium bromide, is applicable to chemically modified plasmid DNA substrates, and produces both positively and negatively supercoiled DNA using a single set of reagents.
[Biophysics of single molecules].
Serdiuk, I N; Deriusheva, E I
2011-01-01
The modern methods of research of biological molecules whose application led to the development of a new field of science, biophysics of single molecules, are reviewed. The measurement of the characteristics of single molecules enables one to reveal their individual features, and it is just for this reason that much more information can be obtained from one molecule than from the entire ensample of molecules. The high sensitivity of the methods considered in detail makes it possible to come close to the solution of the basic problem of practical importance, namely, the determination of the nucleotide sequence of a single DNA molecule.
Single-molecule optical-trapping measurements with DNA anchored to an array of gold nanoposts.
Paik, D Hern; Perkins, Thomas T
2012-01-01
Gold-thiol chemistry is one of the most successful chemistries for conjugating biomolecules to surfaces, but such chemistry has not been exploited in optical-trapping experiments because of laser-induced ablation of gold. In this work, we describe a method to combine these two separate technologies without undue heating using DNA anchored to gold nanostructures (r = 50-250 nm; h ≈ 20 nm). Moreover, we demonstrate a quantitative and mechanically robust (>100 pN) optical-trapping assay. By using three dithiol phosphoramidites (DTPAs) incorporated into a polymerase chain reaction (PCR) primer, the gold-DNA bond remained stable in the presence of excess thiolated compounds. This chemical robustness allowed us to reduce nonspecific sticking by passivating the unreacted gold with methoxy-(polyethylene glycol)-thiol (mPEG-SH). Overall, this surface conjugation of biomolecules onto an ordered array of gold nanostructures by chemically and mechanically robust bonds provides a unique way to carry out spatially controlled, repeatable measurements of single molecules.
Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang
2017-01-01
The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.
Apparatus and method of determining molecular weight of large molecules
Fuerstenau, S.; Benner, W.H.; Madden, N.M.; Searles, W.
1998-06-23
A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e{sup {minus}} are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation. 14 figs.
Apparatus and method of determining molecular weight of large molecules
Fuerstenau, Stephen; Benner, W. Henry; Madden, Norman; Searles, William
1998-01-01
A mass spectrometer determines the mass of multiply charged high molecular weight molecules. This spectrometer utilizes an ion detector which is capable of simultaneously measuring the charge z and transit time of a single ion as it passes through the detector. From this transit time, the velocity of the single ion may then be derived, thus providing the mass-to-charge ratio m/z for a single ion which has been accelerated through a known potential. Given z and m/z, the mass m of the single ion can then be calculated. Electrospray ions with masses in excess of 1 MDa and charge numbers greater than 425 e.sup.- are readily detected. The on-axis single ion detection configuration enables a duty cycle of nearly 100% and extends the practical application of electrospray mass spectrometry to the analysis of very large molecules with relatively inexpensive instrumentation.
Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S
2018-04-18
Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heravi, Mitra; Department of Radiation Oncology, McGill University, Montreal; Segal Cancer Center, Jewish General Hospital, Montreal
2015-06-01
Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Westernmore » blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.« less
Nayak, Alpana; Suresh, K A
2008-08-01
We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.
NASA Astrophysics Data System (ADS)
Nayak, Alpana; Suresh, K. A.
2008-08-01
We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.
DNA motion capture reveals the mechanical properties of DNA at the mesoscale.
Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J
2015-05-19
Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Interferometric observations of large biologically interesting interstellar and cometary molecules
Snyder, Lewis E.
2006-01-01
Interferometric observations of high-mass regions in interstellar molecular clouds have revealed hot molecular cores that have substantial column densities of large, partly hydrogen-saturated molecules. Many of these molecules are of interest to biology and thus are labeled “biomolecules.” Because the clouds containing these molecules provide the material for star formation, they may provide insight into presolar nebular chemistry, and the biomolecules may provide information about the potential of the associated interstellar chemistry for seeding newly formed planets with prebiotic organic chemistry. In this overview, events are outlined that led to the current interferometric array observations. Clues that connect this interstellar hot core chemistry to the solar system can be found in the cometary detection of methyl formate and the interferometric maps of cometary methanol. Major obstacles to understanding hot core chemistry remain because chemical models are not well developed and interferometric observations have not been very sensitive. Differentiation in the molecular isomers glycolaldehdye, methyl formate, and acetic acid has been observed, but not explained. The extended source structure for certain sugars, aldehydes, and alcohols may require nonthermal formation mechanisms such as shock heating of grains. Major advances in understanding the formation chemistry of hot core species can come from observations with the next generation of sensitive, high-resolution arrays. PMID:16894168
DNA recombination activity in soybean mitochondria.
Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L
2006-02-17
Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.
Isotope-selective high-order interferometry with large organic molecules in free fall
NASA Astrophysics Data System (ADS)
Rodewald, Jonas; Dörre, Nadine; Grimaldi, Andrea; Geyer, Philipp; Felix, Lukas; Mayor, Marcel; Shayeghi, Armin; Arndt, Markus
2018-03-01
Interferometry in the time domain has proven valuable for matter-wave based measurements. This concept has recently been generalized to cold molecular clusters using short-pulse standing light waves which realized photo-depletion gratings, arranged in a time-domain Talbot–Lau interferometer (OTIMA). Here we extend this idea further to large organic molecules and demonstrate a new scheme to scan the emerging molecular interferogram in position space. The capability of analyzing different isotopes of the same monomer under identical conditions opens perspectives for studying the interference fringe shift as a function of time in gravitational free fall. The universality of OTIMA interferometry allows one to handle a large variety of particles. In our present work, quasi-continuous laser evaporation allows transferring fragile organic molecules into the gas phase, covering more than an order of magnitude in mass between 614 amu and 6509 amu, i.e. 300% more massive than in previous OTIMA experiments. For all masses, we find about 30% fringe visibility.
DNA of a Human Hepatitis B Virus Candidate
Robinson, William S.; Clayton, David A.; Greenman, Richard L.
1974-01-01
Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328
Isothermal assembly of DNA origami structures using denaturing agents.
Jungmann, Ralf; Liedl, Tim; Sobey, Thomas L; Shih, William; Simmel, Friedrich C
2008-08-06
DNA origami is one of the most promising recent developments in DNA self-assembly. It allows for the construction of arbitrary nanoscale patterns and objects by folding a long viral scaffold strand using a large number of short "staple" strands. Assembly is usually accomplished by thermal annealing of the DNA molecules in buffer solution. We here demonstrate that both 2D and 3D origami structures can be assembled isothermally by annealing the DNA strands in denaturing buffer, followed by a controlled reduction of denaturant concentration. This opens up origami assembly for the integration of temperature-sensitive components.
An optical conveyor for molecules.
Weinert, Franz M; Braun, Dieter
2009-12-01
Trapping single ions under vacuum allows for precise spectroscopy in atomic physics. The confinement of biological molecules in bulk water is hindered by the lack of comparably strong forces. Molecules have been immobilized to surfaces, however often with detrimental effects on their function. Here, we optically trap molecules by creating the microscale analogue of a conveyor belt: a bidirectional flow is combined with a perpendicular thermophoretic molecule drift. Arranged in a toroidal geometry, the conveyor accumulates a hundredfold excess of 5-base DNA within seconds. The concentrations of the trapped DNA scale exponentially with length, reaching trapping potential depths of 14 kT for 50 bases. The mechanism does not require microfluidics, electrodes, or surface modifications. As a result, the trap can be dynamically relocated. The optical conveyor can be used to enhance diffusion-limited surface reactions, redirect cellular signaling, observe individual biomolecules over a prolonged time, or approach single-molecule chemistry in bulk water.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.
Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M
2017-11-17
The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.
Verma, Subhash C.; Lu, Jie; Cai, Qiliang; Kosiyatrakul, Settapong; McDowell, Maria E.; Schildkraut, Carl L.; Robertson, Erle S.
2011-01-01
Kaposi's sarcoma associated herpesvirus (KSHV), an etiologic agent of Kaposi's sarcoma, Body Cavity Based Lymphoma and Multicentric Castleman's Disease, establishes lifelong latency in infected cells. The KSHV genome tethers to the host chromosome with the help of a latency associated nuclear antigen (LANA). Additionally, LANA supports replication of the latent origins within the terminal repeats by recruiting cellular factors. Our previous studies identified and characterized another latent origin, which supported the replication of plasmids ex-vivo without LANA expression in trans. Therefore identification of an additional origin site prompted us to analyze the entire KSHV genome for replication initiation sites using single molecule analysis of replicated DNA (SMARD). Our results showed that replication of DNA can initiate throughout the KSHV genome and the usage of these regions is not conserved in two different KSHV strains investigated. SMARD also showed that the utilization of multiple replication initiation sites occurs across large regions of the genome rather than a specified sequence. The replication origin of the terminal repeats showed only a slight preference for their usage indicating that LANA dependent origin at the terminal repeats (TR) plays only a limited role in genome duplication. Furthermore, we performed chromatin immunoprecipitation for ORC2 and MCM3, which are part of the pre-replication initiation complex to determine the genomic sites where these proteins accumulate, to provide further characterization of potential replication initiation sites on the KSHV genome. The ChIP data confirmed accumulation of these pre-RC proteins at multiple genomic sites in a cell cycle dependent manner. Our data also show that both the frequency and the sites of replication initiation vary within the two KSHV genomes studied here, suggesting that initiation of replication is likely to be affected by the genomic context rather than the DNA sequences. PMID
Ryu, Kyoung-Seok; Tugarinov, Vitali; Clore, G Marius
2014-10-15
The kinetics of translocation of the homeodomain transcription factor HoxD9 between specific sites of the same or opposite polarities on the same DNA molecule have been studied by (15)Nz-exchange NMR spectroscopy. We show that exchange occurs by two facilitated diffusion mechanisms: a second-order intermolecular exchange reaction between specific sites located on different DNA molecules without the protein dissociating into free solution that predominates at high concentrations of free DNA, and a first-order intramolecular process involving direct transfer between specific sites located on the same DNA molecule. Control experiments using a mixture of two DNA molecules, each possessing only a single specific site, indicate that transfer between specific sites by full dissociation of HoxD9 into solution followed by reassociation is too slow to measure by z-exchange spectroscopy. Intramolecular transfer with comparable rate constants occurs between sites of the same and opposing polarity, indicating that both rotation-coupled sliding and hopping/flipping (analogous to geminate recombination) occur. The half-life for intramolecular transfer (0.5-1 s) is many orders of magnitude larger than the calculated transfer time (1-100 μs) by sliding, leading us to conclude that the intramolecular transfer rates measured by z-exchange spectroscopy represent the rate-limiting step for a one-base-pair shift from the specific site to the immediately adjacent nonspecific site. At zero concentration of added salt, the intramolecular transfer rate constants between sites of opposing polarity are smaller than those between sites of the same polarity, suggesting that hopping/flipping may become rate-limiting at very low salt concentrations.
Cristóvão, Michele; Sisamakis, Evangelos; Hingorani, Manju M.; Marx, Andreas D.; Jung, Caroline P.; Rothwell, Paul J.; Seidel, Claus A. M.; Friedhoff, Peter
2012-01-01
Mismatch repair (MMR) corrects replication errors such as mismatched bases and loops in DNA. The evolutionarily conserved dimeric MMR protein MutS recognizes mismatches by stacking a phenylalanine of one subunit against one base of the mismatched pair. In all crystal structures of G:T mismatch-bound MutS, phenylalanine is stacked against thymine. To explore whether these structures reflect directional mismatch recognition by MutS, we monitored the orientation of Escherichia coli MutS binding to mismatches by FRET and anisotropy with steady state, pre-steady state and single-molecule multiparameter fluorescence measurements in a solution. The results confirm that specifically bound MutS bends DNA at the mismatch. We found additional MutS–mismatch complexes with distinct conformations that may have functional relevance in MMR. The analysis of individual binding events reveal significant bias in MutS orientation on asymmetric mismatches (G:T versus T:G, A:C versus C:A), but not on symmetric mismatches (G:G). When MutS is blocked from binding a mismatch in the preferred orientation by positioning asymmetric mismatches near the ends of linear DNA substrates, its ability to authorize subsequent steps of MMR, such as MutH endonuclease activation, is almost abolished. These findings shed light on prerequisites for MutS interactions with other MMR proteins for repairing the appropriate DNA strand. PMID:22367846
ERIC Educational Resources Information Center
Felsenfeld, Gary
1985-01-01
Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, A.N.; Benson, S.C.
1997-07-08
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, A.M.; Benson, S.C.
1998-06-16
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander M.; Benson, Scott C.
1999-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander M.; Benson, Scott C.
1998-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander N.; Benson, Scott C.
1995-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, Alexander N.; Benson, Scott C.
1997-01-01
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.
DNA complexes with dyes designed for energy transfer as fluorescent markers
Glazer, A.N.; Benson, S.C.
1995-03-28
Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figures.
Single-molecule study of the DNA denaturation phase transition in the force-torsion space.
Salerno, D; Tempestini, A; Mai, I; Brogioli, D; Ziano, R; Cassina, V; Mantegazza, F
2012-09-14
We use the "magnetic tweezers" technique to show the structural transitions that the DNA undergoes in the force-torsion space. In particular, we focus on the regions corresponding to negative supercoiling. These regions are characterized by the formation of the so-called denaturation bubbles, which play an essential role in the replication and transcription of DNA. We experimentally map the region of the force-torsion space where the denaturation takes place. We observe that large fluctuations in DNA extension occur at one of the boundaries of this region, i.e., when the formation of denaturation bubbles and of plectonemes compete. To describe the experiments, we introduce a suitable extension of the classical model. The model correctly describes the position of the denaturation regions, the transition boundaries, and the measured values of the DNA extension fluctuations.
Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.
Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan
2008-11-01
Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.
Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions
Brown, Maxwell W.; Kim, Yoori; Williams, Gregory M.; Huck, John D.; Surtees, Jennifer A.; Finkelstein, Ilya J.
2016-01-01
DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2–Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2–Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2–Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2–Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2–Msh3 and Msh2–Msh6 navigate on a crowded genome and suggest how Msh2–Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705
Single-molecule dilution and multiple displacement amplification for molecular haplotyping.
Paul, Philip; Apgar, Josh
2005-04-01
Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.
Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju
2012-01-01
It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.
The unusual and dynamic character of PX-DNA
Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...
2015-07-15
PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less
Model systems for single molecule polymer dynamics
Latinwo, Folarin
2012-01-01
Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980
NASA Astrophysics Data System (ADS)
Seeman, Nadrian C.; Sleiman, Hanadi F.
2018-01-01
DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.
Whitley, Corinna; Gunst, Karin; Müller, Hermann; Funk, Mathis; zur Hausen, Harald
2014-01-01
Epidemiological data point to the involvement of a cow milk factor in the etiology of multiple sclerosis (MS). Eleven circular DNA molecules closely related to transmissible spongiform encephalopathy (TSE)-associated isolate Sphinx 1.76 were isolated from healthy cattle serum, cow milk, and serum and brain tissue from MS patients. PMID:25169859
NASA Astrophysics Data System (ADS)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi
2017-03-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.
New Catalytic DNA Biosensors for Radionuclides and Metal ion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi Lu
2008-03-01
We aim to develop new DNA biosensors for simultaneous detection and quantification of bioavailable radionuclides, such as uranium, technetium, and plutonium, and metal contaminants, such as lead, chromium, and mercury. The sensors will be highly sensitive and selective. They will be applied to on-site, real-time assessment of concentration, speciation, and stability of the individual contaminants before and during bioremediation, and for long-term monitoring of DOE contaminated sites. To achieve this goal, we have employed a combinatorial method called “in vitro selection” to search from a large DNA library (~ 1015 different molecules) for catalytic DNA molecules that are highly specificmore » for radionuclides or other metal ions through intricate 3-dimensional interactions as in metalloproteins. Comprehensive biochemical and biophysical studies have been performed on the selected DNA molecules. The findings from these studies have helped to elucidate fundamental principles for designing effective sensors for radionuclides and metal ions. Based on the study, the DNA have been converted to fluorescent or colorimetric sensors by attaching to it fluorescent donor/acceptor pairs or gold nanoparticles, with 11 part-per-trillion detection limit (for uranium) and over million fold selectivity (over other radionuclides and metal ions tested). Practical application of the biosensors for samples from the Environmental Remediation Sciences Program (ERSP) Field Research Center (FRC) at Oak Ridge has also been demonstrated.« less
In vitro molecular machine learning algorithm via symmetric internal loops of DNA.
Lee, Ji-Hoon; Lee, Seung Hwan; Baek, Christina; Chun, Hyosun; Ryu, Je-Hwan; Kim, Jin-Woo; Deaton, Russell; Zhang, Byoung-Tak
2017-08-01
Programmable biomolecules, such as DNA strands, deoxyribozymes, and restriction enzymes, have been used to solve computational problems, construct large-scale logic circuits, and program simple molecular games. Although studies have shown the potential of molecular computing, the capability of computational learning with DNA molecules, i.e., molecular machine learning, has yet to be experimentally verified. Here, we present a novel molecular learning in vitro model in which symmetric internal loops of double-stranded DNA are exploited to measure the differences between training instances, thus enabling the molecules to learn from small errors. The model was evaluated on a data set of twenty dialogue sentences obtained from the television shows Friends and Prison Break. The wet DNA-computing experiments confirmed that the molecular learning machine was able to generalize the dialogue patterns of each show and successfully identify the show from which the sentences originated. The molecular machine learning model described here opens the way for solving machine learning problems in computer science and biology using in vitro molecular computing with the data encoded in DNA molecules. Copyright © 2017. Published by Elsevier B.V.
Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.; ...
2016-08-30
Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagnik, Gargey B.; Hansen, Rebecca L.; Korte, Andrew R.
Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metalmore » oxide NPs, but chemical interactions are also very important, especially for other NPs. Furthermore, the screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules.« less
Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells
2015-10-01
several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects
Single-Molecule Study of the DNA Denaturation Phase Transition in the Force-Torsion Space
NASA Astrophysics Data System (ADS)
Salerno, D.; Tempestini, A.; Mai, I.; Brogioli, D.; Ziano, R.; Cassina, V.; Mantegazza, F.
2012-09-01
We use the “magnetic tweezers” technique to show the structural transitions that the DNA undergoes in the force-torsion space. In particular, we focus on the regions corresponding to negative supercoiling. These regions are characterized by the formation of the so-called denaturation bubbles, which play an essential role in the replication and transcription of DNA. We experimentally map the region of the force-torsion space where the denaturation takes place. We observe that large fluctuations in DNA extension occur at one of the boundaries of this region, i.e., when the formation of denaturation bubbles and of plectonemes compete. To describe the experiments, we introduce a suitable extension of the classical model. The model correctly describes the position of the denaturation regions, the transition boundaries, and the measured values of the DNA extension fluctuations.
Logistics and quality control for DNA sampling in large multicenter studies.
Nederhand, R J; Droog, S; Kluft, C; Simoons, M L; de Maat, M P M
2003-05-01
To study associations between genetic variation and disease, large bio-banks need to be created in multicenter studies. Therefore, we studied the effects of storage time and temperature on DNA quality and quantity in a simulation experiment with storage up to 28 days frozen, at 4 degrees C and at room temperature. In the simulation experiment, the conditions did not influence the amount or quality of DNA to an unsatisfactory level. However, the amount of extracted DNA was decreased in frozen samples and in samples that were stored for > 7 days at room temperature. In a sample of patients from 24 countries of the EUROPA trial obtained by mail with transport times up to 1 month DNA yield and quality were adequate. From these results we conclude that transport of non-frozen blood by ordinary mail is usable and practical for DNA isolation for polymerase chain reaction in clinical and epidemiological studies.
Regulation of DNA conformations and dynamics in flows with hybrid field microfluidics.
Ren, Fangfang; Zu, Yingbo; Kumar Rajagopalan, Kartik; Wang, Shengnian
2012-01-01
Visualizing single DNA dynamics in flow provides a wealth of physical insights in biophysics and complex flow study. However, large signal fluctuations, generated from diversified conformations, deformation history dependent dynamics and flow induced stochastic tumbling, often frustrate its wide adoption in single molecule and polymer flow study. We use a hybrid field microfluidic (HFM) approach, in which an electric field is imposed at desired locations and appropriate moments to balance the flow stress on charged molecules, to effectively regulate the initial conformations and the deformation dynamics of macromolecules in flow. With λ-DNA and a steady laminar shear flow as the model system, we herein studied the performance of HFM on regulating DNA trapping, relaxation, coil-stretch transition, and accumulation. DNA molecules were found to get captured in the focused planes when motions caused by flow, and the electric field were balanced. The trapped macromolecules relaxed in two different routes while eventually became more uniform in size and globule conformations. When removing the electric field, the sudden stretching dynamics of DNA molecules exhibited a more pronounced extension overshoot in their transient response under a true step function of flow stress while similar behaviors to what other pioneering work in steady shear flow. Such regulation strategies could be useful to control the conformations of other important macromolecules (e.g., proteins) and help better reveal their molecular dynamics.
Yue, Pan; Zhang, Ying; Guo, Zhi-Fo; Cao, Ao-Cheng; Lu, Zhong-Lin; Zhai, Yong-Gong
2015-04-21
A series of bifunctional molecules with different combinations of macrocyclic polyamine [12]aneN3 and coumarin moieties, 4a/b and 5a/b, were synthesized by a two-step copper(I)-mediated alkyne–azide click reactions between 1,3,5-tris(azidomethyl)benzene and Boc-protected N-propynyl-[12]aneN3/7-propynyloxycoumarins. Agarose gel electrophoresis experiments indicated that bifunctional molecules 4b and 5b effectively induced complete plasmid DNA condensation at concentrations up to 40 μM. It was found that the structural variation had a major impact on the condensation behavior of these compounds. The electrostatic interaction involving the [12]aneN3 moiety can be compensated by the binding contribution of the coumarin units during the DNA condensation process. These two types of interaction showed different effects on the reversibility of DNA condensation. Results from studies using dynamic laser scattering, atomic force microscopy, and EB replacement assay further supported the above conclusion. Cytotoxicity assays on bifunctional compounds 4a/b and 5a/b indicated their low cytotoxicity. Results from cellular uptake and cell transfection experiments proved that bifunctional compounds 4b and 5b successfully served as non-viral gene vectors. Furthermore, methyl substituents attached to the coumarin unit (4b and 5b) greatly enhanced their DNA condensation capability and gene transfection. These bifunctional molecules, with the advantages of lower cytotoxicity, good water solubility, and potential structural modification, will have great potential for the development of new non-viral gene delivery agents.
Recombinant DNA encoding a desulfurization biocatalyst
Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.
1994-01-01
This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.
Conformational gating of DNA conductance
Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M. P.; Hihath, Joshua
2015-01-01
DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature. PMID:26648400
Conformational gating of DNA conductance.
Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M P; Hihath, Joshua
2015-12-09
DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature.
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage
2017-01-01
The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway. PMID:28826208
Yang, Li; Sun, Rui; Hase, William L
2011-11-08
In a previous study (J. Chem. Phys.2008, 129, 094701) it was shown that for a large molecule, with a total energy much greater than its barrier for decomposition and whose vibrational modes are harmonic oscillators, the expressions for the classical Rice-Ramsperger-Kassel-Marcus (RRKM) (i.e., RRK) and classical transition-state theory (TST) rate constants become equivalent. Using this relationship, a molecule's unimolecular rate constants versus temperature may be determined from chemical dynamics simulations of microcanonical ensembles for the molecule at different total energies. The simulation identifies the molecule's unimolecular pathways and their Arrhenius parameters. In the work presented here, this approach is used to study the thermal decomposition of CH3-NH-CH═CH-CH3, an important constituent in the polymer of cross-linked epoxy resins. Direct dynamics simulations, at the MP2/6-31+G* level of theory, were used to investigate the decomposition of microcanonical ensembles for this molecule. The Arrhenius A and Ea parameters determined from the direct dynamics simulation are in very good agreement with the TST Arrhenius parameters for the MP2/6-31+G* potential energy surface. The simulation method applied here may be particularly useful for large molecules with a multitude of decomposition pathways and whose transition states may be difficult to determine and have structures that are not readily obvious.
3D DNA Crystals and Nanotechnology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paukstelis, Paul; Seeman, Nadrian
DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
3D DNA Crystals and Nanotechnology
Paukstelis, Paul; Seeman, Nadrian
2016-08-18
DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
Transportin mediates nuclear entry of DNA in vertebrate systems.
Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael
2009-10-01
Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.
Recombinant DNA encoding a desulfurization biocatalyst
Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.
1994-10-18
This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.
Stretching, twisting and supercoiling in short, single DNA molecules
NASA Astrophysics Data System (ADS)
Lam, Pui-Man; Zhen, Yi
2018-02-01
We had combined the Neukirch-Marko model that describes the extension, torque and supercoiling in single, stretched and twisted DNA of infinite contour length, with a form of the free energy suggested by Sinha and Samuels to describe short DNA, with contour length only a few times the persistence length. We find that the free energy of the stretched but untwisted DNA, is significantly modified from its infinitely length value and this in turn modifies significantly the torque and supercoiling. We show that this is consistent with short DNA being more flexible than infinitely long DNA. We hope our results will stimulate experimental investigation of torque and supercoiling in short DNA.
NASA Astrophysics Data System (ADS)
Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie
2015-11-01
Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct
Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej
2018-05-24
Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.
Single-molecule optical genome mapping of a human HapMap and a colorectal cancer cell line.
Teo, Audrey S M; Verzotto, Davide; Yao, Fei; Nagarajan, Niranjan; Hillmer, Axel M
2015-01-01
Next-generation sequencing (NGS) technologies have changed our understanding of the variability of the human genome. However, the identification of genome structural variations based on NGS approaches with read lengths of 35-300 bases remains a challenge. Single-molecule optical mapping technologies allow the analysis of DNA molecules of up to 2 Mb and as such are suitable for the identification of large-scale genome structural variations, and for de novo genome assemblies when combined with short-read NGS data. Here we present optical mapping data for two human genomes: the HapMap cell line GM12878 and the colorectal cancer cell line HCT116. High molecular weight DNA was obtained by embedding GM12878 and HCT116 cells, respectively, in agarose plugs, followed by DNA extraction under mild conditions. Genomic DNA was digested with KpnI and 310,000 and 296,000 DNA molecules (≥ 150 kb and 10 restriction fragments), respectively, were analyzed per cell line using the Argus optical mapping system. Maps were aligned to the human reference by OPTIMA, a new glocal alignment method. Genome coverage of 6.8× and 5.7× was obtained, respectively; 2.9× and 1.7× more than the coverage obtained with previously available software. Optical mapping allows the resolution of large-scale structural variations of the genome, and the scaffold extension of NGS-based de novo assemblies. OPTIMA is an efficient new alignment method; our optical mapping data provide a resource for genome structure analyses of the human HapMap reference cell line GM12878, and the colorectal cancer cell line HCT116.
Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu
2004-01-01
The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.
Ahene, Ago; Calonder, Claudio; Davis, Scott; Kowalchick, Joseph; Nakamura, Takahiro; Nouri, Parya; Vostiar, Igor; Wang, Yang; Wang, Jin
2014-01-01
In recent years, the use of automated sample handling instrumentation has come to the forefront of bioanalytical analysis in order to ensure greater assay consistency and throughput. Since robotic systems are becoming part of everyday analytical procedures, the need for consistent guidance across the pharmaceutical industry has become increasingly important. Pre-existing regulations do not go into sufficient detail in regard to how to handle the use of robotic systems for use with analytical methods, especially large molecule bioanalysis. As a result, Global Bioanalytical Consortium (GBC) Group L5 has put forth specific recommendations for the validation, qualification, and use of robotic systems as part of large molecule bioanalytical analyses in the present white paper. The guidelines presented can be followed to ensure that there is a consistent, transparent methodology that will ensure that robotic systems can be effectively used and documented in a regulated bioanalytical laboratory setting. This will allow for consistent use of robotic sample handling instrumentation as part of large molecule bioanalysis across the globe.
NASA Astrophysics Data System (ADS)
Evangelisti, Luca; Pate, Brooks
2017-06-01
A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on
Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA
NASA Technical Reports Server (NTRS)
Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.
1982-01-01
The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.
Vibronic dephasing model for coherent-to-incoherent crossover in DNA
NASA Astrophysics Data System (ADS)
Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas
2018-05-01
In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.
DNA condensation and size effects of DNA condensation agent
NASA Astrophysics Data System (ADS)
Liu, Yan-Hui; Jiang, Chong-Ming; Guo, Xin-Miao; Tang, Yan-Lin; Hu, Lin
2013-08-01
Based on the model of the strong correlation of counterions condensed on DNA molecule, by tailoring interaction potential, interduplex spacing and correlation spacing between condensed counterions on DNA molecule and interduplex spacing fluctuation strength, toroidal configuration, rod-like configuration and two-hole configurations are possible. The size effects of counterion structure on the toroidal structure can be detected by this model. The autocorrelation function of the tangent vectors is found as an effective way to detect the structure of toroidal conformations and the generic pathway of the process of DNA condensation. The generic pathway of all of the configurations involves an initial nucleation loop, and the next part of the DNA chain is folded on the top of the initial nucleation loop with different manners, in agreement with the recent experimental results.
Single Molecule Enzymology via Nanoelectronic Circuits
NASA Astrophysics Data System (ADS)
Collins, Philip
Traditional single-molecule techniques rely on fluorescence or force transduction to monitor conformational changes and biochemical activity. Recent demonstrations of single-molecule monitoring with electronic transistors are poised to add to the single-molecule research toolkit. The transistor-based technique is sensitive to the motion of single charged side chain residues and can transduce those motions with microsecond resolution, opening the doors to single-molecule enzymology with unprecedented resolution. Furthermore, the solid-state platform provides opportunities for parallelization in arrays and long-duration monitoring of one molecule's activity or processivity, all without the limitations caused by photo-oxidation or mutagenic fluorophore incorporation. This presentation will review some of these advantages and their particular application to DNA polymerase I processing single-stranded DNA templates. This research was supported financially by the NIH NCI (R01 CA133592-01), the NIH NIGMS (1R01GM106957-01) and the NSF (DMR-1104629 and ECCS-1231910).
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya
2015-08-01
Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Nanopore arrays in a silicon membrane for parallel single-molecule detection: fabrication
NASA Astrophysics Data System (ADS)
Schmidt, Torsten; Zhang, Miao; Sychugov, Ilya; Roxhed, Niclas; Linnros, Jan
2015-08-01
Solid state nanopores enable translocation and detection of single bio-molecules such as DNA in buffer solutions. Here, sub-10 nm nanopore arrays in silicon membranes were fabricated by using electron-beam lithography to define etch pits and by using a subsequent electrochemical etching step. This approach effectively decouples positioning of the pores and the control of their size, where the pore size essentially results from the anodizing current and time in the etching cell. Nanopores with diameters as small as 7 nm, fully penetrating 300 nm thick membranes, were obtained. The presented fabrication scheme to form large arrays of nanopores is attractive for parallel bio-molecule sensing and DNA sequencing using optical techniques. In particular the signal-to-noise ratio is improved compared to other alternatives such as nitride membranes suffering from a high-luminescence background.
Nanopore arrays in a silicon membrane for parallel single-molecule detection: fabrication.
Schmidt, Torsten; Zhang, Miao; Sychugov, Ilya; Roxhed, Niclas; Linnros, Jan
2015-08-07
Solid state nanopores enable translocation and detection of single bio-molecules such as DNA in buffer solutions. Here, sub-10 nm nanopore arrays in silicon membranes were fabricated by using electron-beam lithography to define etch pits and by using a subsequent electrochemical etching step. This approach effectively decouples positioning of the pores and the control of their size, where the pore size essentially results from the anodizing current and time in the etching cell. Nanopores with diameters as small as 7 nm, fully penetrating 300 nm thick membranes, were obtained. The presented fabrication scheme to form large arrays of nanopores is attractive for parallel bio-molecule sensing and DNA sequencing using optical techniques. In particular the signal-to-noise ratio is improved compared to other alternatives such as nitride membranes suffering from a high-luminescence background.
Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar
2016-06-03
Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
Structural Transitions in Supercoiled Stretched DNA
NASA Astrophysics Data System (ADS)
v, Croquette
1998-03-01
Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).
Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant
2017-11-01
Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.
Equilibrium softening of an enzyme explored with the DNA spring
NASA Astrophysics Data System (ADS)
Tseng, Chiao-Yu; Zocchi, Giovanni
2014-04-01
We explore enzyme mechanics using a system of two mechanically coupled biomolecules. Measurements of the mechanical modulation of enzymatic activity in a Luciferase—DNA chimera are presented. These are molecules where the enzyme is deformed by the action of a DNA spring. The response of the enzyme for different states of stress is examined. It is found that small changes in the stress cause large changes in activity. This nonlinear behavior is qualitatively interpreted as arising from a soft regime of the enzyme beyond linear elasticity. This soft regime may enable large conformational motion in enzymes.
Jump rates for surface diffusion of large molecules from first principles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen
2015-04-21
We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). Wemore » find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.« less
Multisegment nanowire sensors for the detection of DNA molecules.
Wang, Xu; Ozkan, Cengiz S
2008-02-01
We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.
Measurement of inelastic cross sections for low-energy electron scattering from DNA bases.
Michaud, Marc; Bazin, Marc; Sanche, Léon
2012-01-01
To determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Electron energy loss (EEL) spectra of DNA bases were recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra were then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes were finally obtained from computing the area under the corresponding Gaussians. The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV were reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. The CS for electronic excitations of DNA bases by LEE impact were found to lie within the 10(216) to 10(218) cm(2) range. The large value of the total ionisation CS indicated that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA.
Measurement of inelastic cross sections for low-energy electron scattering from DNA bases
Michaud, Marc; Bazin, Marc.; Sanche, Léon
2013-01-01
Purpose Determine experimentally the absolute cross sections (CS) to deposit various amount of energies into DNA bases by low-energy electron (LEE) impact. Materials and methods Electron energy loss (EEL) spectra of DNA bases are recorded for different LEE impact energies on the molecules deposited at very low coverage on an inert argon (Ar) substrate. Following their normalisation to the effective incident electron current and molecular surface number density, the EEL spectra are then fitted with multiple Gaussian functions in order to delimit the various excitation energy regions. The CS to excite a molecule into its various excitation modes are finally obtained from computing the area under the corresponding Gaussians. Results The EEL spectra and absolute CS for the electronic excitations of pyrimidine and the DNA bases thymine, adenine, and cytosine by electron impacts below 18 eV are reported for the molecules deposited at about monolayer coverage on a solid Ar substrate. Conclusions The CS for electronic excitations of DNA bases by LEE impact are found to lie within the 10−16 – 10−18 cm2 range. The large value of the total ionisation CS indicates that ionisation of DNA bases by LEE is an important dissipative process via which ionising radiation degrades and is absorbed in DNA. PMID:21615242
ERIC Educational Resources Information Center
Robertson, Carol
2016-01-01
Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…
Characterization of individual polynucleotide molecules using a membrane channel
NASA Technical Reports Server (NTRS)
Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.
1996-01-01
We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.
Delivery of large biopharmaceuticals from cardiovascular stents: a review
Takahashi, Hironobu; Letourneur, Didier; Grainger, David W.
2008-01-01
This review focuses on the new and emerging large-molecule bioactive agents delivered from stent surfaces in drug-eluting stents (DES) to inhibit vascular restenosis in the context of interventional cardiology. New therapeutic agents representing proteins, nucleic acids (small interfering RNAs and large DNA plasmids), viral delivery vectors and even engineered cell therapies require specific delivery designs distinct from traditional smaller molecule approaches on DES. While small molecules are currently the clinical standard for coronary stenting, extension of the DES to other lesion types, peripheral vasculature and non-vasculature therapies will seek to deliver an increasingly sophisticated armada of drug types. This review describes many of the larger molecule and biopharmaceutical approaches reported recently for stent-based delivery with the challenges associated with formulating and delivering these drug classes compared to the current small molecule drugs. It also includes perspectives on possible future applications that may improve safety and efficacy and facilitate diversification of the DES to other clinical applications. PMID:17929968
Mechanisms of DNA Packaging by Large Double-Stranded DNA Viruses
Rao, Venigalla B.; Feiss, Michael
2016-01-01
Translocation of viral double-stranded DNA (dsDNA) into the icosahedral prohead shell is catalyzed by TerL, a motor protein that has ATPase, endonuclease, and translocase activities. TerL, following endonucleolytic cleavage of immature viral DNA concatemer recognized by TerS, assembles into a pentameric ring motor on the prohead’s portal vertex and uses ATP hydrolysis energy for DNA translocation. TerL’s N-terminal ATPase is connected by a hinge to the C-terminal endonuclease. Inchworm models propose that modest domain motions accompanying ATP hydrolysis are amplified, through changes in electrostatic interactions, into larger movements of the C-terminal domain bound to DNA. In phage φ29, four of the five TerL subunits sequentially hydrolyze ATP, each powering translocation of 2.5 bp. After one viral genome is encapsidated, the internal pressure signals termination of packaging and ejection of the motor. Current focus is on the structures of packaging complexes and the dynamics of TerL during DNA packaging, endonuclease regulation, and motor mechanics. PMID:26958920
Heterologous mitochondrial DNA recombination in human cells.
D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni
2004-12-15
Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.
Dynamics of flexible molecules in thinning fluid filaments
NASA Astrophysics Data System (ADS)
Arratia, Paulo E.; Juarez, Gabriel
2011-11-01
Newtonian liquids that contain small amounts (~ppm) of flexible polymers can exhibit viscoelastic behavior in extensional flows. In this talk, we report the results of experiments on the thinning and breakup of polymeric fluids in a simple microfluidic device. We aim to understand the stretching dynamics of flexible polymers by direct visualization of fluorescent DNA molecules, a model polymer. A Boger fluid, composed of 100 ppm polyacrylamide and 85% w/w glycerol, is seeded with stained lambdaâDNA molecules (<10% v/v) imaged by high speed epifluorescence microscopy. We observe that the strong flow in the thinning fluid threads provide sufficient forces to stretch the DNA molecules away from their equilibrium coiled state. The distribution of stretch lengths, however, is very heterogeneous due to molecular individualism and initial conditions. Once the molecules are stretched to their full length and aligned with the flow, they translate along the fluid thread as rigid rods until the point of pinch off. After pinch off, both the fluid and molecules return to a relaxed state.
High-throughput DNA separation in nanofilter arrays.
Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong
2014-08-01
We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level
NASA Astrophysics Data System (ADS)
Ray, Sujay
Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Mass Spectrometry as a Preparative Tool for the Surface Science of Large Molecules
NASA Astrophysics Data System (ADS)
Rauschenbach, Stephan; Ternes, Markus; Harnau, Ludger; Kern, Klaus
2016-06-01
Measuring and understanding the complexity that arises when nanostructures interact with their environment are one of the major current challenges of nanoscale science and technology. High-resolution microscopy methods such as scanning probe microscopy have the capacity to investigate nanoscale systems with ultimate precision, for which, however, atomic scale precise preparation methods of surface science are a necessity. Preparative mass spectrometry (pMS), defined as the controlled deposition of m/z filtered ion beams, with soft ionization sources links the world of large, biological molecules and surface science, enabling atomic scale chemical control of molecular deposition in ultrahigh vacuum (UHV). Here we explore the application of high-resolution scanning probe microscopy and spectroscopy to the characterization of structure and properties of large molecules. We introduce the fundamental principles of the combined experiments electrospray ion beam deposition and scanning tunneling microscopy. Examples for the deposition and investigation of single particles, for layer and film growth, and for the investigation of electronic properties of individual nonvolatile molecules show that state-of-the-art pMS technology provides a platform analog to thermal evaporation in conventional molecular beam epitaxy. Additionally, it offers additional, unique features due to the use of charged polyatomic particles. This new field is an enormous sandbox for novel molecular materials research and demands the development of advanced molecular ion beam technology.
Baptiste, Beverly A; Katchur, Steven R; Fivenson, Elayne M; Croteau, Deborah L; Rumsey, William L; Bohr, Vilhelm A
2018-06-04
The common oxidatively generated lesion, 8-oxo-7,8-dihydroguanine (8-oxoGua), is removed from DNA by base excision repair. The glycosylase primarily charged with recognition and removal of this lesion is 8-oxoGuaDNA glycosylase 1 (OGG1). When left unrepaired, 8-oxodG alters transcription and is mutagenic. Individuals homozygous for the less active OGG1 allele, Ser326Cys, have increased risk of several cancers. Here, small molecule enhancers of OGG1 were identified and tested for their ability to stimulate DNA repair and protect cells from the environmental hazard paraquat (PQ). PQ-induced mtDNA damage was inversely proportional to the levels of OGG1 expression whereas stimulation of OGG1, in some cases, entirely abolished its cellular effects. The PQ-mediated decline of mitochondrial membrane potential or nuclear condensation were prevented by the OGG1 activators. In addition, in Ogg1 -/- mouse embryonic fibroblasts complemented with hOGG1 S326C , there was increased cellular and mitochondrial reactive oxygen species compared to their wild type counterparts. Mitochondrial extracts from cells expressing hOGG1 S326C were deficient in mitochondrial 8-oxodG incision activity, which was rescued by the OGG1 activators. These data demonstrate that small molecules can stimulate OGG1 activity with consequent cellular protection. Thus, OGG1-activating compounds may be useful in select humans to mitigate the deleterious effects of environmental oxidants and mutagens. Copyright © 2018 Elsevier Inc. All rights reserved.
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
Comparison of the Single Molecule Dynamics of Linear and Circular DNAs in Planar Extensional Flows
NASA Astrophysics Data System (ADS)
Li, Yanfei; Hsiao, Kai-Wen; Brockman, Christopher; Yates, Daniel; McKenna, Gregory; Schroeder, Charles; San Francisco, Michael; Kornfield, Julie; Anderson, Rae
2015-03-01
Chain topology has a profound impact on the flow behaviors of single macromolecules. The absence of free ends separates circular polymers from other chain architectures, i.e., linear, star, and branched. In the present work, we study the single chain dynamics of large circular and linear DNA molecules by comparing the relaxation dynamics, steady state coil-stretch transition, and transient molecular individualism behaviors for the two types of macromolecules. To this end, large circular DNA molecules were biologically synthesized and studied in a microfluidic device that has a cross-slot geometry to develop a stagnation point extensional flow. Although the relaxation time of rings scales in the same way as for the linear analog, the circular polymers show quantitatively different behaviors in the steady state extension and qualitatively different behaviors during a transient stretch. The existence of some commonality between these two topologies is proposed. Texas Tech University John R. Bradford Endowment.
Discovery of DNA repair inhibitors by combinatorial library profiling
Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih
2011-01-01
Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400
Mining subspace clusters from DNA microarray data using large itemset techniques.
Chang, Ye-In; Chen, Jiun-Rung; Tsai, Yueh-Chi
2009-05-01
Mining subspace clusters from the DNA microarrays could help researchers identify those genes which commonly contribute to a disease, where a subspace cluster indicates a subset of genes whose expression levels are similar under a subset of conditions. Since in a DNA microarray, the number of genes is far larger than the number of conditions, those previous proposed algorithms which compute the maximum dimension sets (MDSs) for any two genes will take a long time to mine subspace clusters. In this article, we propose the Large Itemset-Based Clustering (LISC) algorithm for mining subspace clusters. Instead of constructing MDSs for any two genes, we construct only MDSs for any two conditions. Then, we transform the task of finding the maximal possible gene sets into the problem of mining large itemsets from the condition-pair MDSs. Since we are only interested in those subspace clusters with gene sets as large as possible, it is desirable to pay attention to those gene sets which have reasonable large support values in the condition-pair MDSs. From our simulation results, we show that the proposed algorithm needs shorter processing time than those previous proposed algorithms which need to construct gene-pair MDSs.
Kenney, Rachael M; Buxton, Katherine E; Glazier, Samantha
2016-09-01
Doxorubicin and nogalamycin are antitumor antibiotics that interact with DNA via intercalation and threading mechanisms, respectively. Because the importance of water, particularly its impact on entropy changes, has been established in other biological processes, we investigated the role of water in these two drug-DNA binding events. We used the osmotic stress method to calculate the number of water molecules exchanged (Δnwater), and isothermal titration calorimetry to measure Kbinding, ΔH, and ΔS for two synthetic DNAs, poly(dA·dT) and poly(dG·dC), and calf thymus DNA (CT DNA). For nogalamycin, Δnwater<0 for CT DNA and poly(dG·dC). For doxorubicin, Δnwater>0 for CT DNA and Δnwater<0 for poly(dG·dC). For poly(dA·dT), Δnwater~0 with both drugs. Net enthalpy changes were always negative, but net entropy changes depended on the drug. The effect of water exchange on the overall sign of entropy change appears to be smaller than other contributions. Copyright © 2016 Elsevier B.V. All rights reserved.
Cloud-based MOTIFSIM: Detecting Similarity in Large DNA Motif Data Sets.
Tran, Ngoc Tam L; Huang, Chun-Hsi
2017-05-01
We developed the cloud-based MOTIFSIM on Amazon Web Services (AWS) cloud. The tool is an extended version from our web-based tool version 2.0, which was developed based on a novel algorithm for detecting similarity in multiple DNA motif data sets. This cloud-based version further allows researchers to exploit the computing resources available from AWS to detect similarity in multiple large-scale DNA motif data sets resulting from the next-generation sequencing technology. The tool is highly scalable with expandable AWS.
Macroscopic modeling and simulations of supercoiled DNA with bound proteins
NASA Astrophysics Data System (ADS)
Huang, Jing; Schlick, Tamar
2002-11-01
General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.
Klobutcher, L A; Swanton, M T; Donini, P; Prescott, D M
1981-01-01
In hypotrichous ciliates, all of the macronuclear DNA is in the form of low molecular weight molecules with an average size of approximately 2200 base pairs. Total macronuclear DNA from four hypotrichs has been shown to have inverted terminal repeats by direct sequence analysis. In Oxytricha nova, Oxytricha sp., and Stylonychia pustulata, this terminal sequence may be written as 5'-C4A4C4A4C4 ... 3'-G4T4G4T4G4T4G4T4G4 ... In Euplotes aediculatus, the sequences is similar but differs in the lengths of the duplex region (28 base pairs) and of the putative 3' extension (14 base pairs). Also in Euplotes, a second common sequence of 5 base pairs (A-A-C-T-T-T-T-G-A-A) occurs internal to the terminal repeat and a 17-base-pair heterogeneous region: 5'-C4A4C4A4C4A4C4(X)17T-T-G-A-A ... 3'-G2T4G4T4G4T4G4T4G4T4G4(X)17A-A-C-T-T ... The length of the terminal repeat sequence for O. nova was confirmed in cloned macronuclear DNA molecules. Images PMID:6265931
Structure of faustovirus, a large dsDNA virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klose, Thomas; Reteno, Dorine G.; Benamar, Samia
Many viruses protect their genome with a combination of a protein shell with or without a membrane layer. In this paper, we describe the structure of faustovirus, the first DNA virus (to our knowledge) that has been found to use two protein shells to encapsidate and protect its genome. The crystal structure of the major capsid protein, in combination with cryo-electron microscopy structures of two different maturation stages of the virus, shows that the outer virus shell is composed of a double jelly-roll protein that can be found in many double-stranded DNA viruses. The structure of the repeating hexameric unitmore » of the inner shell is different from all other known capsid proteins. In addition to the unique architecture, the region of the genome that encodes the major capsid protein stretches over 17,000 bp and contains a large number of introns and exons. Finally, this complexity might help the virus to rapidly adapt to new environments or hosts.« less
Structure of faustovirus, a large dsDNA virus
Klose, Thomas; Reteno, Dorine G.; Benamar, Samia; ...
2016-05-16
Many viruses protect their genome with a combination of a protein shell with or without a membrane layer. In this paper, we describe the structure of faustovirus, the first DNA virus (to our knowledge) that has been found to use two protein shells to encapsidate and protect its genome. The crystal structure of the major capsid protein, in combination with cryo-electron microscopy structures of two different maturation stages of the virus, shows that the outer virus shell is composed of a double jelly-roll protein that can be found in many double-stranded DNA viruses. The structure of the repeating hexameric unitmore » of the inner shell is different from all other known capsid proteins. In addition to the unique architecture, the region of the genome that encodes the major capsid protein stretches over 17,000 bp and contains a large number of introns and exons. Finally, this complexity might help the virus to rapidly adapt to new environments or hosts.« less
Enhanced integration of large DNA into E. coli chromosome by CRISPR/Cas9.
Chung, Mu-En; Yeh, I-Hsin; Sung, Li-Yu; Wu, Meng-Ying; Chao, Yun-Peng; Ng, I-Son; Hu, Yu-Chen
2017-01-01
Metabolic engineering often necessitates chromosomal integration of multiple genes but integration of large genes into Escherichia coli remains difficult. CRISPR/Cas9 is an RNA-guided system which enables site-specific induction of double strand break (DSB) and programmable genome editing. Here, we hypothesized that CRISPR/Cas9-triggered DSB could enhance homologous recombination and augment integration of large DNA into E. coli chromosome. We demonstrated that CRISPR/Cas9 system was able to trigger DSB in >98% of cells, leading to subsequent cell death, and identified that mutagenic SOS response played roles in the cell survival. By optimizing experimental conditions and combining the λ-Red proteins and linear dsDNA, CRISPR/Cas9-induced DSB enabled homologous recombination of the donor DNA and replacement of lacZ gene in the MG1655 strain at efficiencies up to 99%, and allowed high fidelity, scarless integration of 2.4, 3.9, 5.4, and 7.0 kb DNA at efficiencies approaching 91%, 92%, 71%, and 61%, respectively. The CRISPR/Cas9-assisted gene integration also functioned in different E. coli strains including BL21 (DE3) and W albeit at different efficiencies. Taken together, our methodology facilitated precise integration of dsDNA as large as 7 kb into E. coli with efficiencies exceeding 60%, thus significantly ameliorating the editing efficiency and overcoming the size limit of integration using the commonly adopted recombineering approach. Biotechnol. Bioeng. 2017;114: 172-183. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Wang, Yongjie; Kleespies, Regina G; Ramle, Moslim B; Jehle, Johannes A
2008-09-01
The genomic sequence analysis of many large dsDNA viruses is hampered by the lack of enough sample materials. Here, we report a whole genome amplification of the Oryctes rhinoceros nudivirus (OrNV) isolate Ma07 starting from as few as about 10 ng of purified viral DNA by application of phi29 DNA polymerase- and exonuclease-resistant random hexamer-based multiple displacement amplification (MDA) method. About 60 microg of high molecular weight DNA with fragment sizes of up to 25 kbp was amplified. A genomic DNA clone library was generated using the product DNA. After 8-fold sequencing coverage, the 127,615 bp of OrNV whole genome was sequenced successfully. The results demonstrate that the MDA-based whole genome amplification enables rapid access to genomic information from exiguous virus samples.
Schiffels, Daniel; Szalai, Veronika A; Liddle, J Alexander
2017-07-25
Robust self-assembly across length scales is a ubiquitous feature of biological systems but remains challenging for synthetic structures. Taking a cue from biology-where disparate molecules work together to produce large, functional assemblies-we demonstrate how to engineer microscale structures with nanoscale features: Our self-assembly approach begins by using DNA polymerase to controllably create double-stranded DNA (dsDNA) sections on a single-stranded template. The single-stranded DNA (ssDNA) sections are then folded into a mechanically flexible skeleton by the origami method. This process simultaneously shapes the structure at the nanoscale and directs the large-scale geometry. The DNA skeleton guides the assembly of RecA protein filaments, which provides rigidity at the micrometer scale. We use our modular design strategy to assemble tetrahedral, rectangular, and linear shapes of defined dimensions. This method enables the robust construction of complex assemblies, greatly extending the range of DNA-based self-assembly methods.
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA
DNA-DNA interaction beyond the ground state
NASA Astrophysics Data System (ADS)
Lee, D. J.; Wynveen, A.; Kornyshev, A. A.
2004-11-01
The electrostatic interaction potential between DNA duplexes in solution is a basis for the statistical mechanics of columnar DNA assemblies. It may also play an important role in recombination of homologous genes. We develop a theory of this interaction that includes thermal torsional fluctuations of DNA using field-theoretical methods and Monte Carlo simulations. The theory extends and rationalizes the earlier suggested variational approach which was developed in the context of a ground state theory of interaction of nonhomologous duplexes. It shows that the heuristic variational theory is equivalent to the Hartree self-consistent field approximation. By comparison of the Hartree approximation with an exact solution based on the QM analogy of path integrals, as well as Monte Carlo simulations, we show that this easily analytically-tractable approximation works very well in most cases. Thermal fluctuations do not remove the ability of DNA molecules to attract each other at favorable azimuthal conformations, neither do they wash out the possibility of electrostatic “snap-shot” recognition of homologous sequences, considered earlier on the basis of ground state calculations. At short distances DNA molecules undergo a “torsional alignment transition,” which is first order for nonhomologous DNA and weaker order for homologous sequences.
Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy
NASA Astrophysics Data System (ADS)
Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong
2013-05-01
Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.
Chandra, Madhavaiah; Keller, Sascha; Gloeckner, Christian; Bornemann, Benjamin; Marx, Andreas
2007-01-01
The Watson-Crick base pairing of DNA is an advantageous phenomenon that can be exploited when using DNA as a scaffold for directed self-organization of nanometer-sized objects. Several reports have appeared in the literature that describe the generation of branched DNA (bDNA) with variable numbers of arms that self-assembles into predesigned architectures. These bDNA units are generated by using cleverly designed rigid crossover DNA molecules. Alternatively, bDNA can be generated by using synthetic branch points derived from either nucleoside or non-nucleoside building blocks. Branched DNA has scarcely been explored for use in nanotechnology or from self-assembling perspectives. Herein, we wish to report our results for the synthesis, characterization, and assembling properties of asymmetrical bDNA molecules that are able to generate linear and circular bDNA constructs. Our strategy for the generation of bDNA is based on a branching point that makes use of a novel protecting-group strategy. The bDNA units were generated by means of automated DNA synthesis methods and were used to generate novel objects by employing chemical and biological techniques. The entities generated might be useful building blocks for DNA-based nanobiotechnology.
Rey, Marie E. C.; Ndunguru, Joseph; Berrie, Leigh C.; Paximadis, Maria; Berry, Shaun; Cossa, Nurbibi; Nuaila, Valter N.; Mabasa, Ken G.; Abraham, Natasha; Rybicki, Edward P.; Martin, Darren; Pietersen, Gerhard; Esterhuizen, Lindy L.
2012-01-01
The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component) or bipartite (two circular ssDNA components called DNA-A and DNA-B), many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-αs) or betasatellites (DNA-βs). Additionally, subgenomic molecules, also known as defective interfering (DIs) DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world. PMID:23170182
Spermine Condenses DNA, but Not RNA Duplexes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.
Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate
Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.
Warwicker, J; Ollis, D; Richards, F M; Steitz, T A
1985-12-05
The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.
Perwez, T; Meyer, R
1996-01-01
An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623
Microfluidic DNA sample preparation method and device
Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.
2002-01-01
Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.
Kühnemund, Malte; Hernández-Neuta, Iván; Sharif, Mohd Istiaq; Cornaglia, Matteo; Gijs, Martin A.M.
2017-01-01
Abstract Single molecule quantification assays provide the ultimate sensitivity and precision for molecular analysis. However, most digital analysis techniques, i.e. droplet PCR, require sophisticated and expensive instrumentation for molecule compartmentalization, amplification and analysis. Rolling circle amplification (RCA) provides a simpler means for digital analysis. Nevertheless, the sensitivity of RCA assays has until now been limited by inefficient detection methods. We have developed a simple microfluidic strategy for enrichment of RCA products into a single field of view of a low magnification fluorescent sensor, enabling ultra-sensitive digital quantification of nucleic acids over a dynamic range from 1.2 aM to 190 fM. We prove the broad applicability of our analysis platform by demonstrating 5-plex detection of as little as ∼1 pg (∼300 genome copies) of pathogenic DNA with simultaneous antibiotic resistance marker detection, and the analysis of rare oncogene mutations. Our method is simpler, more cost-effective and faster than other digital analysis techniques and provides the means to implement digital analysis in any laboratory equipped with a standard fluorescent microscope. PMID:28077562
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kodadek, T.; Gamper, H.
The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less
NASA Astrophysics Data System (ADS)
Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.
2014-09-01
Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.
Small molecules enhance CRISPR genome editing in pluripotent stem cells.
Yu, Chen; Liu, Yanxia; Ma, Tianhua; Liu, Kai; Xu, Shaohua; Zhang, Yu; Liu, Honglei; La Russa, Marie; Xie, Min; Ding, Sheng; Qi, Lei S
2015-02-05
The bacterial CRISPR-Cas9 system has emerged as an effective tool for sequence-specific gene knockout through non-homologous end joining (NHEJ), but it remains inefficient for precise editing of genome sequences. Here we develop a reporter-based screening approach for high-throughput identification of chemical compounds that can modulate precise genome editing through homology-directed repair (HDR). Using our screening method, we have identified small molecules that can enhance CRISPR-mediated HDR efficiency, 3-fold for large fragment insertions and 9-fold for point mutations. Interestingly, we have also observed that a small molecule that inhibits HDR can enhance frame shift insertion and deletion (indel) mutations mediated by NHEJ. The identified small molecules function robustly in diverse cell types with minimal toxicity. The use of small molecules provides a simple and effective strategy to enhance precise genome engineering applications and facilitates the study of DNA repair mechanisms in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.
DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation
Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob
2014-01-01
As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252
Zhang, Jingqing; Boghossian, Ardemis A; Barone, Paul W; Rwei, Alina; Kim, Jong-Ho; Lin, Dahua; Heller, Daniel A; Hilmer, Andrew J; Nair, Nitish; Reuel, Nigel F; Strano, Michael S
2011-01-26
We report the selective detection of single nitric oxide (NO) molecules using a specific DNA sequence of d(AT)(15) oligonucleotides, adsorbed to an array of near-infrared fluorescent semiconducting single-walled carbon nanotubes (AT(15)-SWNT). While SWNT suspended with eight other variant DNA sequences show fluorescence quenching or enhancement from analytes such as dopamine, NADH, L-ascorbic acid, and riboflavin, d(AT)(15) imparts SWNT with a distinct selectivity toward NO. In contrast, the electrostatically neutral polyvinyl alcohol enables no response to nitric oxide, but exhibits fluorescent enhancement to other molecules in the tested library. For AT(15)-SWNT, a stepwise fluorescence decrease is observed when the nanotubes are exposed to NO, reporting the dynamics of single-molecule NO adsorption via SWNT exciton quenching. We describe these quenching traces using a birth-and-death Markov model, and the maximum likelihood estimator of adsorption and desorption rates of NO is derived. Applying the method to simulated traces indicates that the resulting error in the estimated rate constants is less than 5% under our experimental conditions, allowing for calibration using a series of NO concentrations. As expected, the adsorption rate is found to be linearly proportional to NO concentration, and the intrinsic single-site NO adsorption rate constant is 0.001 s(-1) μM NO(-1). The ability to detect nitric oxide quantitatively at the single-molecule level may find applications in new cellular assays for the study of nitric oxide carcinogenesis and chemical signaling, as well as medical diagnostics for inflammation.
Polymorphism of DNA conformation inside the bacteriophage capsid.
Leforestier, Amélie
2013-03-01
Double-stranded DNA bacteriophage genomes are packaged into their icosahedral capsids at the highest densities known so far (about 50 % w:v). How the molecule is folded at such density and how its conformation changes upon ejection or packaging are fascinating questions still largely open. We review cryo-TEM analyses of DNA conformation inside partially filled capsids as a function of the physico-chemical environment (ions, osmotic pressure, temperature). We show that there exists a wide variety of DNA conformations. Strikingly, the different observed structures can be described by some of the different models proposed over the years for DNA organisation inside bacteriophage capsids: either spool-like structures with axial or concentric symmetries, or liquid crystalline structures characterised by a DNA homogeneous density. The relevance of these conformations for the understanding of DNA folding and unfolding upon ejection and packaging in vivo is discussed.
Patel, Vipulkumar; Celec, Peter; Grunt, Magdalena; Schwarzenbach, Heidi; Jenneckens, Ingo; Hillebrand, Timo
2016-01-01
Circulating cell-free DNA (ccfDNA) is a promising diagnostic tool and its size fractionation is of interest. However, kits for isolation of ccfDNA available on the market are designed for small volumes hence processing large sample volumes is laborious. We have tested a new method that enables enrichment of ccfDNA from large volumes of plasma and subsequently allows size-fractionation of isolated ccfDNA into two fractions with individually established cut-off levels of ccfDNA length. This method allows isolation of low-abundant DNA as well as separation of long and short DNA molecules. This procedure may be important e.g., in prenatal diagnostics and cancer research that have been already confirmed by our primary experiments. Here, we report the results of selective separation of 200- and 500-bp long synthetic DNA fragments spiked in plasma samples. Furthermore, we size-fractionated ccfDNA from the plasma of pregnant women and verified the prevalence of fetal ccfDNA in all fractions.
An evolution based biosensor receptor DNA sequence generation algorithm.
Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng
2010-01-01
A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.
Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu
2006-10-01
In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.
NASA Astrophysics Data System (ADS)
Huang, Da; Freeley, Mark; Palma, Matteo
2017-03-01
We present a facile strategy of general applicability for the assembly of individual nanoscale moieties in array configurations with single-molecule control. Combining the programming ability of DNA as a scaffolding material with a one-step lithographic process, we demonstrate the patterning of single quantum dots (QDs) at predefined locations on silicon and transparent glass surfaces: as proof of concept, clusters of either one, two, or three QDs were assembled in highly uniform arrays with a 60 nm interdot spacing within each cluster. Notably, the platform developed is reusable after a simple cleaning process and can be designed to exhibit different geometrical arrangements.
Binding and thermodynamics of REV peptide-ctDNA interaction.
Upadhyay, Santosh Kumar
2017-03-01
The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically
Logic Gate Operation by DNA Translocation through Biological Nanopores.
Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji
2016-01-01
Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.
Logic Gate Operation by DNA Translocation through Biological Nanopores
Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji
2016-01-01
Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568
Simultaneous non-contiguous deletions using large synthetic DNA and site-specific recombinases
Krishnakumar, Radha; Grose, Carissa; Haft, Daniel H.; Zaveri, Jayshree; Alperovich, Nina; Gibson, Daniel G.; Merryman, Chuck; Glass, John I.
2014-01-01
Toward achieving rapid and large scale genome modification directly in a target organism, we have developed a new genome engineering strategy that uses a combination of bioinformatics aided design, large synthetic DNA and site-specific recombinases. Using Cre recombinase we swapped a target 126-kb segment of the Escherichia coli genome with a 72-kb synthetic DNA cassette, thereby effectively eliminating over 54 kb of genomic DNA from three non-contiguous regions in a single recombination event. We observed complete replacement of the native sequence with the modified synthetic sequence through the action of the Cre recombinase and no competition from homologous recombination. Because of the versatility and high-efficiency of the Cre-lox system, this method can be used in any organism where this system is functional as well as adapted to use with other highly precise genome engineering systems. Compared to present-day iterative approaches in genome engineering, we anticipate this method will greatly speed up the creation of reduced, modularized and optimized genomes through the integration of deletion analyses data, transcriptomics, synthetic biology and site-specific recombination. PMID:24914053
Recent advances in DNA nanotechnology.
Chidchob, Pongphak; Sleiman, Hanadi F
2018-05-08
DNA is a powerful guiding molecule to achieve the precise construction of arbitrary structures and high-resolution organization of functional materials. The combination of sequence programmability, rigidity and highly specific molecular recognition in this molecule has resulted in a wide range of exquisitely designed DNA frameworks. To date, the impressive potential of DNA nanomaterials has been demonstrated from fundamental research to technological advancements in materials science and biomedicine. This review presents a summary of some of the most recent developments in structural DNA nanotechnology regarding new assembly approaches and efforts in translating DNA nanomaterials into practical use. Recent work on incorporating blunt-end stacking and hydrophobic interactions as orthogonal instruction rules in DNA assembly, and several emerging applications of DNA nanomaterials will also be highlighted. Copyright © 2018. Published by Elsevier Ltd.
Notation Confusion of Symmetry Species for Molecules with Several Large-Amplitude Internal Motions
NASA Astrophysics Data System (ADS)
Groner, P.
2011-06-01
The Mulliken convention has become the standard notation for symmetry species (irreducible representations) of point groups for quasi-rigid molecules. No such convention exists for symmetry species of symmetry groups for semi-rigid or non-rigid molecules with large amplitude internal motions (LAMs). As a result, we have a situation where we create notations in a do-it-yourself fashion or adopt them from the literature, sometimes even without proper reference to its derivation or to the character table on which it is based. This may be just a nuisance for those who are comfortable enough with group theory and molecular symmetry groups to figure "it" out, but it represents a real problem for everybody else. The notation confusion is illustrated with examples from the literature (both old and new) on molecules with two or more LAMs. Most authors use the notation introduced by Myers and Wilson for molecules such as acetone or propane. No universal notation is in use for molecules with two methyl groups but lower overall symmetry. For example, the notation G_1_8 is used for one of these groups. As it turns out, different people use the same notation for different groups. This presentation is an attempt to bring some light into the dark and to combat confusion with a call for an anti-confusion convention. R. S. Mulliken, Phys. Rev. 43, 279 (1933). R. J. Myers, E. B. Wilson, J. Chem. Phys. 33, 186 (1960).
Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling
NASA Astrophysics Data System (ADS)
Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.
2007-02-01
We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.
DNA-Based Applications in Nanobiotechnology
Abu-Salah, Khalid M.; Ansari, Anees A.; Alrokayan, Salman A.
2010-01-01
Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated. PMID:20652049
DNA-based applications in nanobiotechnology.
Abu-Salah, Khalid M; Ansari, Anees A; Alrokayan, Salman A
2010-01-01
Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.
Kim, Ari; Yen, Paul; Mroczek, Marta; Nouri, Mannan; Lien, Scott; Axerio-Cilies, Peter; Dalal, Kush; Yau, Clement; Ghaidi, Fariba; Guo, Yubin; Yamazaki, Takeshi; Lawn, Sam; Gleave, Martin E.; Gregory-Evans, Cheryl Y.
2017-01-01
Genomic alterations involving translocations of the ETS-related gene ERG occur in approximately half of prostate cancer cases. These alterations result in aberrant, androgen-regulated production of ERG protein variants that directly contribute to disease development and progression. This study describes the discovery and characterization of a new class of small molecule ERG antagonists identified through rational in silico methods. These antagonists are designed to sterically block DNA binding by the ETS domain of ERG and thereby disrupt transcriptional activity. We confirmed the direct binding of a lead compound, VPC-18005, with the ERG-ETS domain using biophysical approaches. We then demonstrated VPC-18005 reduced migration and invasion rates of ERG expressing prostate cancer cells, and reduced metastasis in a zebrafish xenograft model. These results demonstrate proof-of-principal that small molecule targeting of the ERG-ETS domain can suppress transcriptional activity and reverse transformed characteristics of prostate cancers aberrantly expressing ERG. Clinical advancement of the developed small molecule inhibitors may provide new therapeutic agents for use as alternatives to, or in combination with, current therapies for men with ERG-expressing metastatic castration-resistant prostate cancer. PMID:28465491
NASA Astrophysics Data System (ADS)
Hurst, A.; Bowden, S. A.; Parnell, J.; Burchell, M. J.; Ball, A. J.
2007-12-01
There are a number of measurements relevant to planetary geology that can only be adequately performed by physically contacting a sample. This necessitates landing on the surface of a moon or planetary body or returning samples to earth. The need to physically contact a sample is particularly important in the case of measurements that could detect medium to low concentrations of large organic molecules present in surface materials. Large organic molecules, although a trace component of many meteoritic materials and rocks on the surface of earth, carry crucial information concerning the processing of meteoritic material in the surface and subsurface environments, and can be crucial indicators for the presence of life. Unfortunately landing on the surface of a small planetary body or moon is complicated, particularly if surface topography is only poorly characterised and the atmosphere thin thus requiring a propulsion system for a soft landing. One alternative to a surface landing may be to use an impactor launched from an orbiting spacecraft to launch material from the planets surface and shallow sub-surface into orbit. Ejected material could then be collected by a follow-up spacecraft and analyzed. The mission scenario considered in the Europa-Ice Clipper mission proposal included both sample return and the analysis of captured particles. Employing such a sampling procedure to analyse large organic molecules is only viable if large organic molecules present in ices survive hypervelocity impacts (HVIs). To investigate the survival of large organic molecules in HVIs with icy bodies a two stage light air gas gun was used to fire steel projectiles (1-1.5 mm diameter) at samples of water ice containing large organic molecules (amino acids, anthracene and beta-carotene a biological pigment) at velocities > 4.8 km/s.UV-VIS spectroscopy of ejected material detected beta-carotene indicating large organic molecules can survive hypervelocity impacts. These preliminary results
Probabilistic switching circuits in DNA
Wilhelm, Daniel; Bruck, Jehoshua
2018-01-01
A natural feature of molecular systems is their inherent stochastic behavior. A fundamental challenge related to the programming of molecular information processing systems is to develop a circuit architecture that controls the stochastic states of individual molecular events. Here we present a systematic implementation of probabilistic switching circuits, using DNA strand displacement reactions. Exploiting the intrinsic stochasticity of molecular interactions, we developed a simple, unbiased DNA switch: An input signal strand binds to the switch and releases an output signal strand with probability one-half. Using this unbiased switch as a molecular building block, we designed DNA circuits that convert an input signal to an output signal with any desired probability. Further, this probability can be switched between 2n different values by simply varying the presence or absence of n distinct DNA molecules. We demonstrated several DNA circuits that have multiple layers and feedback, including a circuit that converts an input strand to an output strand with eight different probabilities, controlled by the combination of three DNA molecules. These circuits combine the advantages of digital and analog computation: They allow a small number of distinct input molecules to control a diverse signal range of output molecules, while keeping the inputs robust to noise and the outputs at precise values. Moreover, arbitrarily complex circuit behaviors can be implemented with just a single type of molecular building block. PMID:29339484
High-Throughput DNA sequencing of ancient wood.
Wagner, Stefanie; Lagane, Frédéric; Seguin-Orlando, Andaine; Schubert, Mikkel; Leroy, Thibault; Guichoux, Erwan; Chancerel, Emilie; Bech-Hebelstrup, Inger; Bernard, Vincent; Billard, Cyrille; Billaud, Yves; Bolliger, Matthias; Croutsch, Christophe; Čufar, Katarina; Eynaud, Frédérique; Heussner, Karl Uwe; Köninger, Joachim; Langenegger, Fabien; Leroy, Frédéric; Lima, Christine; Martinelli, Nicoletta; Momber, Garry; Billamboz, André; Nelle, Oliver; Palomo, Antoni; Piqué, Raquel; Ramstein, Marianne; Schweichel, Roswitha; Stäuble, Harald; Tegel, Willy; Terradas, Xavier; Verdin, Florence; Plomion, Christophe; Kremer, Antoine; Orlando, Ludovic
2018-03-01
Reconstructing the colonization and demographic dynamics that gave rise to extant forests is essential to forecasts of forest responses to environmental changes. Classical approaches to map how population of trees changed through space and time largely rely on pollen distribution patterns, with only a limited number of studies exploiting DNA molecules preserved in wooden tree archaeological and subfossil remains. Here, we advance such analyses by applying high-throughput (HTS) DNA sequencing to wood archaeological and subfossil material for the first time, using a comprehensive sample of 167 European white oak waterlogged remains spanning a large temporal (from 550 to 9,800 years) and geographical range across Europe. The successful characterization of the endogenous DNA and exogenous microbial DNA of 140 (~83%) samples helped the identification of environmental conditions favouring long-term DNA preservation in wood remains, and started to unveil the first trends in the DNA decay process in wood material. Additionally, the maternally inherited chloroplast haplotypes of 21 samples from three periods of forest human-induced use (Neolithic, Bronze Age and Middle Ages) were found to be consistent with those of modern populations growing in the same geographic areas. Our work paves the way for further studies aiming at using ancient DNA preserved in wood to reconstruct the micro-evolutionary response of trees to climate change and human forest management. © 2018 John Wiley & Sons Ltd.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.
O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R
2017-10-17
Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery
2017-01-01
Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to
DNA under Force: Mechanics, Electrostatics, and Hydration.
Li, Jingqiang; Wijeratne, Sithara S; Qiu, Xiangyun; Kiang, Ching-Hwa
2015-02-25
Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.
Conformation-dependent DNA attraction
NASA Astrophysics Data System (ADS)
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-05-01
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by
Optical mapping and its potential for large-scale sequencing projects.
Aston, C; Mishra, B; Schwartz, D C
1999-07-01
Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.
NASA Astrophysics Data System (ADS)
Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C.
2003-01-01
Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L III shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l -1) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.
Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.
El-Diasty, Fouad; Abdel-Wahab, Fathy
2015-10-01
The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.
Multi-wavelength search for complex molecules in Titan's Atmosphere
NASA Astrophysics Data System (ADS)
Nixon, C. A.; Cordiner, M. A.; Greathouse, T. K.; Richter, M.; Kisiel, Z.; Irwin, P. G.; Teanby, N. A.; Kuan, Y. J.; Charnley, S. B.
2017-12-01
Titan's atmosphere is one of the most complex astrochemical environments known: the photochemistry of methane and nitrogen, induced by solar UV and Saturn magnetospheric electron impacts, creates a bonanza of organic molecules like no other place in the solar system. Cassini has unveiled the first glimpses of Titan's chemical wonderland, but many gaps remain. In particular, interpreting the mass spectra of Titan's upper atmosphere requires external knowledge, to disentangle the signature of molecules from their identical-mass brethren. Cassini infrared spectroscopy with CIRS has helped to some extent, but is also limited by low spectral resolution. Potentially to the rescue, comes high-resolution spectroscopy from the Earth at infrared and sub-millimeter wavelengths, where molecules exhibit vibrational and rotational transitions respectively. In this presentation, we describe the quest to make new, unique identifications of large molecules in Titan's atmosphere, focusing specifically on cyclic molecules including N-heterocycles. This molecular family is of high astrobiological significance, forming the basic ring structure for DNA nucleobases. We present the latest spectroscopic observations of Titan from ALMA and NASA's IRTF telescope, discussing present findings and directions for future work.
Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.
2012-01-01
X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624
Quantitative DNA fiber mapping
Gray, Joe W.; Weier, Heinz-Ulrich G.
1998-01-01
The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.
AFEAP cloning: a precise and efficient method for large DNA sequence assembly.
Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin
2017-11-14
Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.
Effect of genome sequence on the force-induced unzipping of a DNA molecule.
Singh, N; Singh, Y
2006-02-01
We considered a dsDNA polymer in which distribution of bases are random at the base pair level but ordered at a length of 18 base pairs and calculated its force elongation behaviour in the constant extension ensemble. The unzipping force F(y) vs. extension y is found to have a series of maxima and minima. By changing base pairs at selected places in the molecule we calculated the change in F(y) curve and found that the change in the value of force is of the order of few pN and the range of the effect depending on the temperature, can spread over several base pairs. We have also discussed briefly how to calculate in the constant force ensemble a pause or a jump in the extension-time curve from the knowledge of F(y).
NASA Astrophysics Data System (ADS)
Nagaiwa, Hidenori; Aibara, Daijiro; Ikeda, Yoshihisa; Motomura, Hideki; Kido, Yugo; Satoh, Susumu; Tachibana, Kunihide; Jinno, Masahumi
2015-09-01
The authors have been developing a novel gene transfection method using microplasma irradiation. In order to clarify the mechanism of large molecule permeation process through the lipid bilayer, plasma induced outflow of hydrophilic fluorescent dye molecules, which were encapsulated in the liposome, was observed. By microplasma irradiation on the liposome suspension, the dyes flowed out from the inside of the liposomes. The outflow of the dyes was enhanced by longer plasma irradiation time. Investigation of the outflow mechanism, i.e. permeation enhancement of the lipid bilayer or burst of the liposome, is under progress. This work was partly supported by JSPS KAKENHI Grant-in-Aid for Scientific Research on Innovative Areas (Number 25108509,15H00896) and a grant from Ehime University.
Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.
2017-01-16
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.
Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less
Diversity of large DNA viruses of invertebrates.
Williams, Trevor; Bergoin, Max; van Oers, Monique M
2017-07-01
In this review we provide an overview of the diversity of large DNA viruses known to be pathogenic for invertebrates. We present their taxonomical classification and describe the evolutionary relationships among various groups of invertebrate-infecting viruses. We also indicate the relationships of the invertebrate viruses to viruses infecting mammals or other vertebrates. The shared characteristics of the viruses within the various families are described, including the structure of the virus particle, genome properties, and gene expression strategies. Finally, we explain the transmission and mode of infection of the most important viruses in these families and indicate, which orders of invertebrates are susceptible to these pathogens. Copyright © 2016 Elsevier Inc. All rights reserved.
Solving traveling salesman problems with DNA molecules encoding numerical values.
Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak
2004-12-01
We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.
Mass transfer of large molecules through collagen and collagen-silica hybrid membranes
NASA Astrophysics Data System (ADS)
Jofre-Lora, Pedro
Diabetes is a growing concern in the United States and around the world that must be addressed through new treatment options. Current standard treatment options of diabetes are limiting and have tremendous impacts on patient's lives. Emerging therapies, such as the implantation of encapsulated islets, are promising treatment options, but have not yet materialized due to unsolved problems with material properties. Hybrid silica-collagen membranes address some of these unsolved problems and are a promising material for cell encapsulation. However, the mass transfer properties of large molecules, such as insulin, TNF-alpha, IL1beta, and other important proteins in the etiology of diabetes, through these hybrid membranes are poorly characterized. In order to begin characterizing these properties, a device was constructed to accurately and efficiently measure the mass transfer of other similar large molecules, fluorescein isothiocyanate dextrans (FITC-dextran), through collagen-silica hybrid membranes. The device was used to measure diffusion coefficients of 4, 20, 40, and 150 kDa FITC-dextrans through non-silicified and silicified samples of 200 and 1000 Pa porcine skin collagen. Diffusion coefficients were found to be in the 10-7-10-6 cm2s -1 range, which is in agreement with previously published data for similar molecules through similar hydrogels. The effects of collagen stiffness, FITC-dextran molecular weight, and silicification treatment on diffusion were investigated. It was found that collagen stiffness and FITC-dextran molecular weight had a negative correlation with diffusion, whereas silicification treatment had no global impact on diffusion. The device created, and the results of this preliminary investigation, can be used to develop collagen-silica hybrid membranes as an alternative material for cell encapsulation in a forward-design manner.
Searching target sites on DNA by proteins: Role of DNA dynamics under confinement
Mondal, Anupam; Bhattacherjee, Arnab
2015-01-01
DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158
Gao, Ting; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Liu, Chang; Chen, Shilin
2010-10-26
Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels.
Human Mitochondrial DNA Replication
Holt, Ian J.; Reyes, Aurelio
2012-01-01
Elucidation of the process of DNA replication in mitochondria is in its infancy. For many years, maintenance of the mitochondrial genome was regarded as greatly simplified compared to the nucleus. Mammalian mitochondria were reported to lack all DNA repair systems, to eschew DNA recombination, and to possess but a single DNA polymerase, polymerase γ. Polγ was said to replicate mitochondrial DNA exclusively via one mechanism, involving only two priming events and a handful of proteins. In this “strand-displacement model,” leading strand DNA synthesis begins at a specific site and advances approximately two-thirds of the way around the molecule before DNA synthesis is initiated on the “lagging” strand. Although the displaced strand was long-held to be coated with protein, RNA has more recently been proposed in its place. Furthermore, mitochondrial DNA molecules with all the features of products of conventional bidirectional replication have been documented, suggesting that the process and regulation of replication in mitochondria is complex, as befits a genome that is a core factor in human health and longevity. PMID:23143808
Preparation and self-folding of amphiphilic DNA origami.
Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng
2015-03-01
Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA confinement in nanochannels: physics and biological applications
NASA Astrophysics Data System (ADS)
Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.
2012-10-01
DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.
DNA confinement in nanochannels: physics and biological applications.
Reisner, Walter; Pedersen, Jonas N; Austin, Robert H
2012-10-01
DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.
Irc3 is a mitochondrial DNA branch migration enzyme
Gaidutšik, Ilja; Sedman, Tiina; Sillamaa, Sirelin; Sedman, Juhan
2016-01-01
Integrity of mitochondrial DNA (mtDNA) is essential for cellular energy metabolism. In the budding yeast Saccharomyces cerevisiae, a large number of nuclear genes influence the stability of mitochondrial genome; however, most corresponding gene products act indirectly and the actual molecular mechanisms of mtDNA inheritance remain poorly characterized. Recently, we found that a Superfamily II helicase Irc3 is required for the maintenance of mitochondrial genome integrity. Here we show that Irc3 is a mitochondrial DNA branch migration enzyme. Irc3 modulates mtDNA metabolic intermediates by preferential binding and unwinding Holliday junctions and replication fork structures. Furthermore, we demonstrate that the loss of Irc3 can be complemented with mitochondrially targeted RecG of Escherichia coli. We suggest that Irc3 could support the stability of mtDNA by stimulating fork regression and branch migration or by inhibiting the formation of irregular branched molecules. PMID:27194389
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, Huamin; Smith, Lloyd M.
1997-01-01
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, H.; Smith, L.M.
1997-01-07
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.
Trehalose facilitates DNA melting: a single-molecule optical tweezers study.
Bezrukavnikov, Sergey; Mashaghi, Alireza; van Wijk, Roeland J; Gu, Chan; Yang, Li Jiang; Gao, Yi Qin; Tans, Sander J
2014-10-07
Using optical tweezers, here we show that the overstretching transition force of double-stranded DNA (dsDNA) is lowered significantly by the addition of the disaccharide trehalose as well as certain polyol osmolytes. This effect is found to depend linearly on the logarithm of the trehalose concentration. We propose an entropic driving mechanism for the experimentally observed destabilization of dsDNA that is rooted in the higher affinity of the DNA bases for trehalose than for water, which promotes base exposure and DNA melting. Molecular dynamics simulation reveals the direct interaction of trehalose with nucleobases. Experiments with other osmolytes confirm that the extent of dsDNA destabilization is governed by the ratio between polar and apolar fractions of an osmolyte.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Mitochondrial DNA copy number threshold in mtDNA depletion myopathy.
Durham, S E; Bonilla, E; Samuels, D C; DiMauro, S; Chinnery, P F
2005-08-09
The authors measured the absolute amount of mitochondrial DNA (mtDNA) within single muscle fibers from two patients with thymidine kinase 2 (TK2) deficiency and two healthy controls. TK2 deficient fibers containing more than 0.01 mtDNA/microm3 had residual cytochrome c oxidase (COX) activity. This defines the minimum amount of wild-type mtDNA molecules required to maintain COX activity in skeletal muscle and provides an explanation for the mosaic histochemical pattern seen in patients with mtDNA depletion syndrome.
Methods And Devices For Characterizing Duplex Nucleic Acid Molecules
Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen
2005-08-30
Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.